Incidental Mutation 'R5765:Mtnr1b'
ID446231
Institutional Source Beutler Lab
Gene Symbol Mtnr1b
Ensembl Gene ENSMUSG00000050901
Gene Namemelatonin receptor 1B
SynonymsMt2, Mel1b
MMRRC Submission 043366-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5765 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location15824528-15874556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15863163 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 200 (Y200C)
Ref Sequence ENSEMBL: ENSMUSP00000138524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057920] [ENSMUST00000182947]
Predicted Effect probably damaging
Transcript: ENSMUST00000057920
AA Change: Y200C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053086
Gene: ENSMUSG00000050901
AA Change: Y200C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 254 3.7e-11 PFAM
Pfam:7TM_GPCR_Srsx 51 323 2.6e-12 PFAM
Pfam:7tm_1 57 308 3.4e-47 PFAM
Pfam:7TM_GPCR_Srv 59 317 1.1e-7 PFAM
low complexity region 348 359 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182947
AA Change: Y200C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138524
Gene: ENSMUSG00000050901
AA Change: Y200C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 264 1.8e-10 PFAM
Pfam:7TM_GPCR_Srsx 51 323 2.6e-12 PFAM
Pfam:7tm_1 57 308 1.4e-50 PFAM
Pfam:7TM_GPCR_Srv 59 319 7.5e-8 PFAM
low complexity region 348 359 N/A INTRINSIC
Meta Mutation Damage Score 0.9038 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This gene product is an integral membrane protein that is a G-protein coupled, 7-transmembrane receptor. It is found primarily in the retina and brain although this detection requires RT-PCR. It is thought to participate in light-dependent functions in the retina and may be involved in the neurobiological effects of melatonin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display no obvious circadian phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,153,240 probably benign Het
4833423E24Rik T G 2: 85,484,194 probably null Het
Abcf2 T C 5: 24,573,423 R246G probably damaging Het
Adamts19 G T 18: 59,052,582 C1176F probably damaging Het
Adh7 G A 3: 138,226,329 V235I probably benign Het
Caprin2 G C 6: 148,843,168 P701A probably damaging Het
Casp7 T C 19: 56,433,883 V110A possibly damaging Het
Cd1d2 A T 3: 86,987,242 M106L probably benign Het
Cntnap2 C T 6: 46,529,815 probably benign Het
Cpm A G 10: 117,671,733 I252V probably benign Het
Dnaaf2 A C 12: 69,192,853 I631M probably damaging Het
Doxl2 C T 6: 48,978,537 P694S probably damaging Het
Fam117b A G 1: 59,970,472 probably null Het
Fbxw22 T C 9: 109,384,996 M251V probably benign Het
Fignl1 T C 11: 11,802,011 probably null Het
Foxp1 G A 6: 99,015,462 L156F probably damaging Het
Gdap1 A T 1: 17,161,426 M332L probably benign Het
H2-M3 T C 17: 37,272,443 F265S probably damaging Het
Il1rl1 C T 1: 40,461,943 A493V probably benign Het
Iqce A G 5: 140,666,140 S359P probably damaging Het
Kif2b C T 11: 91,577,242 E72K probably benign Het
Luzp1 T C 4: 136,541,029 S188P probably damaging Het
Med13l T A 5: 118,728,642 L587Q probably damaging Het
Mocs2 A G 13: 114,826,156 probably null Het
Nalcn C T 14: 123,464,726 V458I possibly damaging Het
Nbea C T 3: 56,005,298 V1023I probably benign Het
Nbeal1 T A 1: 60,291,847 V2205D probably damaging Het
Nfe2l3 A G 6: 51,457,246 D262G probably damaging Het
Nsfl1c T C 2: 151,504,165 Y169H probably damaging Het
Pcdhac1 A T 18: 37,090,319 R62* probably null Het
Pcdhga1 A G 18: 37,663,661 T573A probably benign Het
Plin4 C T 17: 56,102,470 C1276Y possibly damaging Het
Ppp6r1 C A 7: 4,642,208 R220L possibly damaging Het
Ptprz1 T G 6: 23,000,236 V775G probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc17a6 A G 7: 51,625,501 T103A possibly damaging Het
Spock1 A T 13: 57,429,404 L404Q probably benign Het
Stradb C A 1: 58,992,744 H272N probably benign Het
Strn3 A G 12: 51,633,627 S397P probably benign Het
Synpo2l C T 14: 20,666,130 R126H possibly damaging Het
Tas2r104 A G 6: 131,685,273 Y158H probably benign Het
Tiparp T A 3: 65,531,350 I29N possibly damaging Het
Tnpo1 G A 13: 98,859,841 T484M probably benign Het
Tsc22d4 A G 5: 137,758,543 I78V probably benign Het
Ugt2b1 T C 5: 86,919,406 Y386C probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Vmn2r116 G A 17: 23,401,404 C704Y probably damaging Het
Vmn2r97 T A 17: 18,947,180 Y565* probably null Het
Zfand2b T A 1: 75,170,527 probably null Het
Zzef1 C T 11: 72,821,937 Q228* probably null Het
Other mutations in Mtnr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Mtnr1b APN 9 15863200 missense probably damaging 1.00
IGL02041:Mtnr1b APN 9 15863293 missense probably benign 0.01
IGL02054:Mtnr1b APN 9 15874240 missense possibly damaging 0.93
IGL02147:Mtnr1b APN 9 15863376 missense probably damaging 0.96
IGL02620:Mtnr1b APN 9 15874321 missense possibly damaging 0.47
IGL03046:Mtnr1b UTSW 9 15862763 missense probably benign 0.00
R0362:Mtnr1b UTSW 9 15874304 missense probably damaging 1.00
R0784:Mtnr1b UTSW 9 15862785 missense probably benign 0.17
R1323:Mtnr1b UTSW 9 15863136 missense probably damaging 1.00
R1323:Mtnr1b UTSW 9 15863136 missense probably damaging 1.00
R1572:Mtnr1b UTSW 9 15863142 missense probably damaging 0.99
R1600:Mtnr1b UTSW 9 15863319 missense probably damaging 0.99
R2880:Mtnr1b UTSW 9 15862806 missense probably damaging 1.00
R2932:Mtnr1b UTSW 9 15874324 missense probably damaging 0.97
R4033:Mtnr1b UTSW 9 15863534 missense probably damaging 1.00
R5532:Mtnr1b UTSW 9 15862914 missense probably benign
R5775:Mtnr1b UTSW 9 15862872 missense possibly damaging 0.73
R5893:Mtnr1b UTSW 9 15863244 missense probably damaging 0.98
R6025:Mtnr1b UTSW 9 15862797 missense probably damaging 1.00
R6247:Mtnr1b UTSW 9 15862786 missense probably benign
R6349:Mtnr1b UTSW 9 15863213 nonsense probably null
R6364:Mtnr1b UTSW 9 15863004 missense possibly damaging 0.63
R7485:Mtnr1b UTSW 9 15863294 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGGCCGATACAGTTGAGG -3'
(R):5'- TGCTGCATCTGTCATAGTACC -3'

Sequencing Primer
(F):5'- GCATATGGCAAAAACCACAAACACTG -3'
(R):5'- GCATCTGTCATAGTACCACCTAC -3'
Posted On2016-11-21