Mutagenetix > Incidental Mutation

Incidental Mutation 'R5766:Aspm'

446256

Institutional Source

Beutler Lab

Gene Symbol

Aspm

Ensembl Gene

ENSMUSG00000033952

Gene Name

abnormal spindle microtubule assembly

Synonyms

Aspm, Sha1, MCPH5, D330028K02Rik, Calmbp1

MMRRC Submission

044424-MU

Accession Numbers

Genbank: NM_009791; MGI: 1334448

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5766 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

139454772-139494091 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 139479002 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1876 (F1876L)

Ref Sequence

ENSEMBL: ENSMUSP00000059159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053364] [ENSMUST00000200083]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000053364
AA Change: F1876L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000059159
Gene: ENSMUSG00000033952
AA Change: F1876L

Domain	Start	End	E-Value	Type
Pfam:ASH	29	126	8.9e-35	PFAM
low complexity region	855	861	N/A	INTRINSIC
CH	890	1022	2.04e0	SMART
CH	1080	1224	5.56e-9	SMART
IQ	1233	1255	7.57e0	SMART
IQ	1259	1281	1.12e1	SMART
IQ	1282	1304	3.73e-1	SMART
IQ	1314	1336	2.41e-4	SMART
IQ	1360	1382	2.12e1	SMART
IQ	1387	1408	7.61e1	SMART
IQ	1409	1431	6.97e0	SMART
IQ	1432	1452	1.44e1	SMART
IQ	1453	1475	1.15e-1	SMART
IQ	1476	1495	1.66e2	SMART
IQ	1503	1525	1.65e-2	SMART
IQ	1526	1548	1.32e1	SMART
IQ	1549	1571	1.48e1	SMART
IQ	1572	1594	2.5e1	SMART
IQ	1599	1621	2.58e-4	SMART
IQ	1622	1644	6.7e-3	SMART
IQ	1645	1667	4.25e1	SMART
IQ	1668	1694	1.03e2	SMART
IQ	1695	1717	2.33e-2	SMART
IQ	1718	1740	7.79e0	SMART
IQ	1741	1763	1.57e2	SMART
IQ	1768	1790	2.68e-2	SMART
IQ	1791	1813	5.83e-3	SMART
IQ	1814	1836	5.93e1	SMART
IQ	1841	1863	1.92e-3	SMART
IQ	1864	1886	3.79e-2	SMART
IQ	1914	1936	4.11e0	SMART
IQ	1937	1959	1.87e-1	SMART
IQ	1960	1982	6.27e1	SMART
IQ	1987	2009	8.25e-3	SMART
IQ	2010	2032	5.73e0	SMART
IQ	2060	2082	1.39e0	SMART
IQ	2083	2105	4.62e1	SMART
IQ	2133	2155	5.58e0	SMART
IQ	2156	2178	7.07e-2	SMART
IQ	2206	2228	1.18e-3	SMART
IQ	2229	2251	4.59e0	SMART
IQ	2278	2300	1.85e-5	SMART
IQ	2301	2323	8.13e-2	SMART
IQ	2342	2364	9.62e-4	SMART
IQ	2365	2387	4.12e-3	SMART
IQ	2415	2437	7.58e-2	SMART
IQ	2438	2460	2.6e0	SMART
IQ	2490	2512	1.68e-3	SMART
IQ	2513	2535	8.51e1	SMART
IQ	2560	2582	2.14e-1	SMART
IQ	2601	2623	8.46e0	SMART
IQ	2647	2669	1.15e1	SMART
IQ	2673	2695	1.95e-4	SMART
IQ	2696	2718	4.13e1	SMART
IQ	2723	2745	1.02e-2	SMART
IQ	2761	2783	3.14e2	SMART
IQ	2784	2806	1e1	SMART
IQ	2825	2847	2.43e0	SMART
IQ	2848	2870	4.6e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196272

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199998

Predicted Effect

probably benign
Transcript: ENSMUST00000200083

SMART Domains

Protein: ENSMUSP00000142880
Gene: ENSMUSG00000033952

Domain	Start	End	E-Value	Type
low complexity region	855	861	N/A	INTRINSIC
CH	890	1022	2.04e0	SMART
CH	1080	1224	5.56e-9	SMART
IQ	1233	1255	7.57e0	SMART
IQ	1259	1281	1.12e1	SMART
IQ	1282	1304	3.73e-1	SMART
IQ	1314	1336	1.25e1	SMART
IQ	1337	1358	2.96e1	SMART
IQ	1382	1404	1.15e1	SMART
IQ	1408	1430	1.95e-4	SMART
IQ	1431	1453	4.13e1	SMART
IQ	1458	1480	1.02e-2	SMART
IQ	1496	1518	3.14e2	SMART
IQ	1519	1541	1e1	SMART
IQ	1560	1582	2.43e0	SMART
IQ	1583	1605	4.6e-1	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for protein-truncating gene trap mutations of this gene exhibit decreased body weight, microcephaly, a severe reduction in brain, testis and ovary weight, oligozoospermia and asthenospermia, and reduced fertility in both sexes. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	G	A	7: 28,137,329	W224*	probably null	Het
Aadacl3	A	G	4: 144,455,869	V343A	probably damaging	Het
AI429214	TCCCTGATGAAC	TC	8: 36,994,229		probably null	Het
Arid2	A	G	15: 96,372,205	T1400A	probably benign	Het
Arrdc1	G	A	2: 24,926,405	T184I	probably damaging	Het
Calhm1	C	T	19: 47,143,703	V158I	probably benign	Het
Caly	T	C	7: 140,070,397	K211E	probably benign	Het
Cenpe	T	C	3: 135,248,413	L1677P	probably damaging	Het
Cttnbp2	A	G	6: 18,381,033	V1388A	possibly damaging	Het
Dgkd	C	T	1: 87,880,449	R80*	probably null	Het
Dnah3	A	T	7: 119,978,222	I2072N	probably damaging	Het
Dnah8	A	G	17: 30,690,261	I1020M	probably benign	Het
Drc3	T	C	11: 60,393,821	V484A	probably benign	Het
Efcab8	A	G	2: 153,780,992	D27G	possibly damaging	Het
Fat4	G	A	3: 38,889,468	G837R	probably damaging	Het
Fgb	A	T	3: 83,046,176	C96S	probably damaging	Het
Flt4	G	C	11: 49,626,686	W278C	possibly damaging	Het
Fmnl2	T	C	2: 53,101,454	V327A	probably damaging	Het
Fras1	A	T	5: 96,731,689	Y2455F	possibly damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm13872	T	A	2: 102,737,909	I88N	probably damaging	Het
Hoxa6	A	G	6: 52,208,414	S71P	probably benign	Het
Hunk	T	A	16: 90,453,739	C148S	probably damaging	Het
Ighv1-18	A	C	12: 114,682,907	S26A	probably damaging	Het
Impg2	T	G	16: 56,259,820	D553E	possibly damaging	Het
Ints1	A	G	5: 139,772,145	I266T	probably benign	Het
Kpna3	G	T	14: 61,403,014	T33K	probably benign	Het
Lamb1	A	G	12: 31,299,931	D622G	probably damaging	Het
Lamp3	T	C	16: 19,701,317	T39A	probably damaging	Het
Mnt	C	T	11: 74,843,078		probably benign	Het
Msh4	A	G	3: 153,867,840	S726P	probably damaging	Het
Olfr539	T	A	7: 140,667,353	V22E	probably benign	Het
Pah	A	C	10: 87,567,347	K195Q	probably damaging	Het
Pdc	T	A	1: 150,333,500	*245K	probably null	Het
Pdzd8	A	T	19: 59,300,540	H809Q	possibly damaging	Het
Plekhd1	A	T	12: 80,722,366	I467L	probably benign	Het
Ppp2ca	A	G	11: 52,113,187	D57G	probably damaging	Het
Ralgapa1	A	T	12: 55,820,766	M1K	probably null	Het
Rfx2	T	A	17: 56,803,587	D133V	probably benign	Het
Scfd2	A	T	5: 74,462,651	L407Q	probably damaging	Het
Scp2d1	T	A	2: 144,824,037	S99T	possibly damaging	Het
Sec63	A	T	10: 42,801,681	N261I	probably damaging	Het
Slc8a1	T	C	17: 81,648,961	Y216C	probably damaging	Het
Son	T	A	16: 91,664,987		probably benign	Het
Syce1	T	C	7: 140,777,981	E285G	probably damaging	Het
Taar7a	G	T	10: 23,993,362	S40R	probably benign	Het
Ube3a	A	T	7: 59,276,059	D216V	possibly damaging	Het
Vgll2	A	G	10: 52,027,563	D174G	probably damaging	Het
Vmn2r17	A	T	5: 109,427,273	T149S	possibly damaging	Het
Zbtb39	G	T	10: 127,742,688	C377F	probably damaging	Het
Zfp820	T	A	17: 21,820,002	N115I	probably damaging	Het
Zfp948	T	C	17: 21,584,816	S23P	probably benign	Het

Other mutations in Aspm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Aspm	APN	1	139478691	missense	probably damaging	1.00
IGL00594:Aspm	APN	1	139487422	splice site	probably benign
IGL00808:Aspm	APN	1	139461476	missense	probably benign	0.03
IGL00897:Aspm	APN	1	139477407	missense	probably damaging	0.98
IGL01024:Aspm	APN	1	139478124	missense	possibly damaging	0.66
IGL01410:Aspm	APN	1	139482444	missense	probably benign	0.25
IGL01588:Aspm	APN	1	139478162	missense	probably benign	0.11
IGL01610:Aspm	APN	1	139489670	nonsense	probably null
IGL01633:Aspm	APN	1	139480836	missense	possibly damaging	0.93
IGL01982:Aspm	APN	1	139491588	missense	probably benign	0.12
IGL02429:Aspm	APN	1	139479810	missense	probably benign	0.27
IGL02468:Aspm	APN	1	139480950	missense	probably damaging	1.00
IGL02519:Aspm	APN	1	139461927	splice site	probably benign
IGL02526:Aspm	APN	1	139489719	missense	probably benign	0.03
IGL02716:Aspm	APN	1	139479687	missense	probably damaging	1.00
IGL02876:Aspm	APN	1	139473653	missense	probably damaging	1.00
IGL02953:Aspm	APN	1	139457419	missense	probably benign	0.01
IGL03275:Aspm	APN	1	139487295	missense	probably damaging	1.00
Stemware	UTSW	1	139477459	nonsense	probably null
3-1:Aspm	UTSW	1	139457541	missense	probably benign
R0016:Aspm	UTSW	1	139479544	missense	probably benign	0.01
R0016:Aspm	UTSW	1	139479544	missense	probably benign	0.01
R0106:Aspm	UTSW	1	139476876	missense	probably benign	0.02
R0106:Aspm	UTSW	1	139476876	missense	probably benign	0.02
R0140:Aspm	UTSW	1	139480641	missense	probably benign	0.00
R0195:Aspm	UTSW	1	139479135	missense	probably damaging	1.00
R0217:Aspm	UTSW	1	139457880	missense	possibly damaging	0.46
R0276:Aspm	UTSW	1	139478471	missense	possibly damaging	0.95
R0309:Aspm	UTSW	1	139482511	splice site	probably benign
R0466:Aspm	UTSW	1	139477901	missense	probably damaging	1.00
R0520:Aspm	UTSW	1	139478820	missense	possibly damaging	0.51
R0615:Aspm	UTSW	1	139487289	missense	probably damaging	1.00
R0626:Aspm	UTSW	1	139491601	missense	probably damaging	1.00
R0660:Aspm	UTSW	1	139457764	missense	probably benign	0.03
R0751:Aspm	UTSW	1	139456898	splice site	probably benign
R0830:Aspm	UTSW	1	139474254	missense	probably damaging	0.99
R1109:Aspm	UTSW	1	139456758	missense	probably damaging	0.99
R1114:Aspm	UTSW	1	139461924	splice site	probably benign
R1130:Aspm	UTSW	1	139477834	missense	possibly damaging	0.90
R1298:Aspm	UTSW	1	139457419	missense	probably benign	0.01
R1386:Aspm	UTSW	1	139457623	missense	probably benign	0.03
R1386:Aspm	UTSW	1	139478972	missense	possibly damaging	0.80
R1557:Aspm	UTSW	1	139468668	missense	probably benign	0.01
R1625:Aspm	UTSW	1	139481039	missense	probably benign	0.01
R1728:Aspm	UTSW	1	139473574	missense	probably benign
R1729:Aspm	UTSW	1	139473574	missense	probably benign
R1730:Aspm	UTSW	1	139473574	missense	probably benign
R1733:Aspm	UTSW	1	139457117	missense	probably benign	0.27
R1739:Aspm	UTSW	1	139473574	missense	probably benign
R1762:Aspm	UTSW	1	139473574	missense	probably benign
R1783:Aspm	UTSW	1	139473574	missense	probably benign
R1784:Aspm	UTSW	1	139473574	missense	probably benign
R1785:Aspm	UTSW	1	139473574	missense	probably benign
R1793:Aspm	UTSW	1	139457341	missense	probably benign	0.00
R1893:Aspm	UTSW	1	139479867	missense	probably damaging	1.00
R1911:Aspm	UTSW	1	139478094	missense	probably benign	0.06
R2103:Aspm	UTSW	1	139491665	missense	probably damaging	0.99
R2128:Aspm	UTSW	1	139457635	missense	probably benign	0.14
R2129:Aspm	UTSW	1	139457635	missense	probably benign	0.14
R2239:Aspm	UTSW	1	139456846	missense	possibly damaging	0.67
R2352:Aspm	UTSW	1	139457562	missense	probably benign	0.02
R2353:Aspm	UTSW	1	139477697	missense	probably damaging	1.00
R2380:Aspm	UTSW	1	139479348	missense	probably damaging	1.00
R2413:Aspm	UTSW	1	139477757	missense	probably damaging	1.00
R2421:Aspm	UTSW	1	139488487	missense	possibly damaging	0.49
R3607:Aspm	UTSW	1	139480668	missense	probably benign	0.13
R3711:Aspm	UTSW	1	139458100	missense	probably benign	0.17
R3718:Aspm	UTSW	1	139480889	missense	probably benign	0.09
R3718:Aspm	UTSW	1	139490427	missense	probably benign	0.31
R3741:Aspm	UTSW	1	139478619	missense	possibly damaging	0.47
R3788:Aspm	UTSW	1	139463203	missense	probably damaging	1.00
R3838:Aspm	UTSW	1	139478054	missense	probably benign	0.24
R3839:Aspm	UTSW	1	139478054	missense	probably benign	0.24
R3849:Aspm	UTSW	1	139458286	missense	probably benign	0.21
R4075:Aspm	UTSW	1	139474285	missense	probably damaging	1.00
R4080:Aspm	UTSW	1	139470755	missense	probably damaging	1.00
R4463:Aspm	UTSW	1	139455010	missense	possibly damaging	0.95
R4537:Aspm	UTSW	1	139474303	missense	probably benign	0.01
R4547:Aspm	UTSW	1	139478187	missense	possibly damaging	0.75
R4573:Aspm	UTSW	1	139479507	missense	probably damaging	0.98
R4680:Aspm	UTSW	1	139480671	missense	probably benign	0.05
R4807:Aspm	UTSW	1	139477919	missense	probably damaging	1.00
R4840:Aspm	UTSW	1	139470531	missense	possibly damaging	0.83
R4854:Aspm	UTSW	1	139478072	nonsense	probably null
R4859:Aspm	UTSW	1	139469393	missense	probably damaging	1.00
R4893:Aspm	UTSW	1	139489839	critical splice donor site	probably null
R4910:Aspm	UTSW	1	139491543	missense	probably damaging	1.00
R4953:Aspm	UTSW	1	139471734	missense	probably benign	0.00
R4974:Aspm	UTSW	1	139478010	missense	probably benign	0.03
R4981:Aspm	UTSW	1	139470760	splice site	probably null
R5082:Aspm	UTSW	1	139478676	nonsense	probably null
R5223:Aspm	UTSW	1	139478334	missense	probably damaging	1.00
R5268:Aspm	UTSW	1	139464295	missense	probably damaging	1.00
R5371:Aspm	UTSW	1	139470541	nonsense	probably null
R5377:Aspm	UTSW	1	139457483	missense	probably damaging	0.96
R5377:Aspm	UTSW	1	139470395	splice site	probably null
R5481:Aspm	UTSW	1	139457061	missense	possibly damaging	0.85
R5513:Aspm	UTSW	1	139482398	missense	probably damaging	1.00
R5578:Aspm	UTSW	1	139470717	missense	probably damaging	1.00
R5649:Aspm	UTSW	1	139479669	missense	probably benign
R5685:Aspm	UTSW	1	139487288	missense	probably benign	0.10
R5695:Aspm	UTSW	1	139479669	missense	probably benign
R5964:Aspm	UTSW	1	139455227	intron	probably benign
R5993:Aspm	UTSW	1	139479531	missense	probably benign	0.28
R6027:Aspm	UTSW	1	139463056	missense	probably damaging	1.00
R6029:Aspm	UTSW	1	139480990	missense	possibly damaging	0.83
R6102:Aspm	UTSW	1	139477459	nonsense	probably null
R6188:Aspm	UTSW	1	139479239	missense	possibly damaging	0.79
R6257:Aspm	UTSW	1	139482053	splice site	probably null
R6433:Aspm	UTSW	1	139473683	missense	probably damaging	1.00
R6682:Aspm	UTSW	1	139457722	missense	possibly damaging	0.67
R6763:Aspm	UTSW	1	139470517	missense	possibly damaging	0.64
R6798:Aspm	UTSW	1	139468685	missense	possibly damaging	0.66
R6815:Aspm	UTSW	1	139480142	missense	probably benign	0.04
R6854:Aspm	UTSW	1	139463182	missense	possibly damaging	0.90
R6928:Aspm	UTSW	1	139480206	nonsense	probably null
R6943:Aspm	UTSW	1	139480542	missense	probably damaging	1.00
R6979:Aspm	UTSW	1	139480485	missense	probably damaging	1.00
R6998:Aspm	UTSW	1	139469472	missense	probably damaging	1.00
R7126:Aspm	UTSW	1	139480803	missense	probably benign	0.27
R7237:Aspm	UTSW	1	139477929	missense	possibly damaging	0.81
R7240:Aspm	UTSW	1	139478651	nonsense	probably null
R7272:Aspm	UTSW	1	139458328	missense	probably benign	0.14
R7427:Aspm	UTSW	1	139457616	missense	probably benign	0.01
R7519:Aspm	UTSW	1	139490336	missense	possibly damaging	0.53
R7776:Aspm	UTSW	1	139479846	missense	possibly damaging	0.85
R7875:Aspm	UTSW	1	139455134	missense	probably benign	0.02
R7883:Aspm	UTSW	1	139478667	missense	possibly damaging	0.47
R7964:Aspm	UTSW	1	139480686	missense	probably damaging	1.00
R8012:Aspm	UTSW	1	139457464	missense	probably benign	0.03
R8029:Aspm	UTSW	1	139471632	missense	probably benign	0.00
R8233:Aspm	UTSW	1	139457304	missense	probably benign	0.28
R8277:Aspm	UTSW	1	139455010	missense	probably damaging	1.00
R8345:Aspm	UTSW	1	139464273	nonsense	probably null
R8491:Aspm	UTSW	1	139457695	missense	probably damaging	0.98
R8511:Aspm	UTSW	1	139457308	missense	probably damaging	1.00
R8557:Aspm	UTSW	1	139456756	missense	probably benign	0.01
R8927:Aspm	UTSW	1	139490387	nonsense	probably null
R8928:Aspm	UTSW	1	139490387	nonsense	probably null
R8950:Aspm	UTSW	1	139478952	missense	probably damaging	1.00
R9033:Aspm	UTSW	1	139478127	missense	probably damaging	1.00
R9083:Aspm	UTSW	1	139493698	missense	possibly damaging	0.70
R9133:Aspm	UTSW	1	139491528	missense	probably damaging	1.00
R9160:Aspm	UTSW	1	139490124	missense	probably damaging	1.00
R9179:Aspm	UTSW	1	139476715	missense	probably damaging	1.00
R9265:Aspm	UTSW	1	139461444	missense	probably benign	0.24
R9400:Aspm	UTSW	1	139479903	missense	probably damaging	1.00
R9419:Aspm	UTSW	1	139457185	missense	probably benign	0.29
R9454:Aspm	UTSW	1	139480994	missense	probably benign	0.00
R9517:Aspm	UTSW	1	139479429	missense	probably damaging	1.00
R9524:Aspm	UTSW	1	139480869	missense	probably damaging	1.00
R9544:Aspm	UTSW	1	139457785	missense	probably benign	0.01
R9640:Aspm	UTSW	1	139480272	missense	possibly damaging	0.88
R9698:Aspm	UTSW	1	139461908	missense	probably benign	0.28
R9790:Aspm	UTSW	1	139480637	missense	probably damaging	0.98
R9791:Aspm	UTSW	1	139480637	missense	probably damaging	0.98
R9794:Aspm	UTSW	1	139478742	missense	probably damaging	0.99
X0063:Aspm	UTSW	1	139458090	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGCTTCAGTCTGCTGTGAAG -3'
(R):5'- ATATGACTGTATGAGGGCAGCG -3'

Sequencing Primer
(F):5'- CTTCAGTCTGCTGTGAAGATTCAG -3'
(R):5'- ATTGATGCTGCCGGGCAATC -3'

Posted On

2016-11-21