Incidental Mutation 'R5766:Olfr539'
ID446278
Institutional Source Beutler Lab
Gene Symbol Olfr539
Ensembl Gene ENSMUSG00000059136
Gene Nameolfactory receptor 539
SynonymsMOR253-4, GA_x6K02T2PBJ9-42813436-42814368
MMRRC Submission 044424-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5766 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140659930-140678580 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140667353 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 22 (V22E)
Ref Sequence ENSEMBL: ENSMUSP00000077990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078967] [ENSMUST00000210973] [ENSMUST00000218865]
Predicted Effect probably benign
Transcript: ENSMUST00000078967
AA Change: V22E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000077990
Gene: ENSMUSG00000059136
AA Change: V22E

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 6.5e-50 PFAM
Pfam:7tm_1 50 299 4.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210973
AA Change: V15E
Predicted Effect probably benign
Transcript: ENSMUST00000218865
AA Change: V15E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219853
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,137,329 W224* probably null Het
Aadacl3 A G 4: 144,455,869 V343A probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Arid2 A G 15: 96,372,205 T1400A probably benign Het
Arrdc1 G A 2: 24,926,405 T184I probably damaging Het
Aspm T C 1: 139,479,002 F1876L probably damaging Het
Calhm1 C T 19: 47,143,703 V158I probably benign Het
Caly T C 7: 140,070,397 K211E probably benign Het
Cenpe T C 3: 135,248,413 L1677P probably damaging Het
Cttnbp2 A G 6: 18,381,033 V1388A possibly damaging Het
Dgkd C T 1: 87,880,449 R80* probably null Het
Dnah3 A T 7: 119,978,222 I2072N probably damaging Het
Dnah8 A G 17: 30,690,261 I1020M probably benign Het
Drc3 T C 11: 60,393,821 V484A probably benign Het
Efcab8 A G 2: 153,780,992 D27G possibly damaging Het
Fat4 G A 3: 38,889,468 G837R probably damaging Het
Fgb A T 3: 83,046,176 C96S probably damaging Het
Flt4 G C 11: 49,626,686 W278C possibly damaging Het
Fmnl2 T C 2: 53,101,454 V327A probably damaging Het
Fras1 A T 5: 96,731,689 Y2455F possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm13872 T A 2: 102,737,909 I88N probably damaging Het
Hoxa6 A G 6: 52,208,414 S71P probably benign Het
Hunk T A 16: 90,453,739 C148S probably damaging Het
Ighv1-18 A C 12: 114,682,907 S26A probably damaging Het
Impg2 T G 16: 56,259,820 D553E possibly damaging Het
Ints1 A G 5: 139,772,145 I266T probably benign Het
Kpna3 G T 14: 61,403,014 T33K probably benign Het
Lamb1 A G 12: 31,299,931 D622G probably damaging Het
Lamp3 T C 16: 19,701,317 T39A probably damaging Het
Mnt C T 11: 74,843,078 probably benign Het
Msh4 A G 3: 153,867,840 S726P probably damaging Het
Pah A C 10: 87,567,347 K195Q probably damaging Het
Pdc T A 1: 150,333,500 *245K probably null Het
Pdzd8 A T 19: 59,300,540 H809Q possibly damaging Het
Plekhd1 A T 12: 80,722,366 I467L probably benign Het
Ppp2ca A G 11: 52,113,187 D57G probably damaging Het
Ralgapa1 A T 12: 55,820,766 M1K probably null Het
Rfx2 T A 17: 56,803,587 D133V probably benign Het
Scfd2 A T 5: 74,462,651 L407Q probably damaging Het
Scp2d1 T A 2: 144,824,037 S99T possibly damaging Het
Sec63 A T 10: 42,801,681 N261I probably damaging Het
Slc8a1 T C 17: 81,648,961 Y216C probably damaging Het
Son T A 16: 91,664,987 probably benign Het
Syce1 T C 7: 140,777,981 E285G probably damaging Het
Taar7a G T 10: 23,993,362 S40R probably benign Het
Ube3a A T 7: 59,276,059 D216V possibly damaging Het
Vgll2 A G 10: 52,027,563 D174G probably damaging Het
Vmn2r17 A T 5: 109,427,273 T149S possibly damaging Het
Zbtb39 G T 10: 127,742,688 C377F probably damaging Het
Zfp820 T A 17: 21,820,002 N115I probably damaging Het
Zfp948 T C 17: 21,584,816 S23P probably benign Het
Other mutations in Olfr539
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr539 APN 7 140667941 missense probably benign 0.01
IGL01610:Olfr539 APN 7 140667671 missense probably damaging 1.00
IGL02959:Olfr539 APN 7 140667550 missense probably damaging 1.00
IGL03406:Olfr539 APN 7 140667511 missense probably damaging 1.00
R0671:Olfr539 UTSW 7 140667677 missense probably damaging 1.00
R1771:Olfr539 UTSW 7 140668135 missense probably benign
R1934:Olfr539 UTSW 7 140668038 nonsense probably null
R1985:Olfr539 UTSW 7 140667821 missense probably damaging 1.00
R2962:Olfr539 UTSW 7 140667949 missense probably benign
R4239:Olfr539 UTSW 7 140667583 missense probably benign 0.07
R4240:Olfr539 UTSW 7 140667583 missense probably benign 0.07
R4360:Olfr539 UTSW 7 140667817 missense probably damaging 0.98
R4841:Olfr539 UTSW 7 140667589 missense probably damaging 1.00
R4842:Olfr539 UTSW 7 140667589 missense probably damaging 1.00
R4851:Olfr539 UTSW 7 140667313 missense probably benign
R5325:Olfr539 UTSW 7 140667792 missense probably benign 0.33
R6363:Olfr539 UTSW 7 140668082 missense possibly damaging 0.93
R6836:Olfr539 UTSW 7 140668180 missense possibly damaging 0.86
R7777:Olfr539 UTSW 7 140667941 missense probably benign 0.01
R7920:Olfr539 UTSW 7 140667901 missense possibly damaging 0.92
R8134:Olfr539 UTSW 7 140667767 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGCTTACACGAAGGAAATACATTTG -3'
(R):5'- TGTTTTCCTCAGACACTAGGCC -3'

Sequencing Primer
(F):5'- CGAAGGAAATACATTTGTTCCGAGCC -3'
(R):5'- TACAGATAATGTCCATGGTGGCC -3'
Posted On2016-11-21