Incidental Mutation 'R5766:Syce1'
ID446279
Institutional Source Beutler Lab
Gene Symbol Syce1
Ensembl Gene ENSMUSG00000025480
Gene Namesynaptonemal complex central element protein 1
Synonyms4933406J07Rik
MMRRC Submission 044424-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5766 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140777229-140787852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140777981 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 285 (E285G)
Ref Sequence ENSEMBL: ENSMUSP00000026553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026552] [ENSMUST00000026553] [ENSMUST00000209253] [ENSMUST00000210235] [ENSMUST00000211616]
Predicted Effect probably benign
Transcript: ENSMUST00000026552
SMART Domains Protein: ENSMUSP00000026552
Gene: ENSMUSG00000025479

DomainStartEndE-ValueType
transmembrane domain 2 23 N/A INTRINSIC
Pfam:p450 33 489 1.4e-147 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000026553
AA Change: E285G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026553
Gene: ENSMUSG00000025480
AA Change: E285G

DomainStartEndE-ValueType
Pfam:SYCE1 49 200 5.5e-66 PFAM
coiled coil region 237 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209253
Predicted Effect probably benign
Transcript: ENSMUST00000210235
Predicted Effect probably benign
Transcript: ENSMUST00000211616
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptonemal complex, which links homologous chromosomes during prophase I of meiosis. The tripartite structure of the complex is highly conserved amongst metazoans. It consists of two lateral elements and a central region formed by transverse elements and a central element. The protein encoded by this gene localizes to the central element and is required for initiation and elongation of the synapsis. Allelic variants of this gene have been associated with premature ovarian failure and spermatogenic failure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit small ovaries and small testes, severe defects in gametogenesis, and infertility in both sexes. Meiosis is arrested, homologous chromosomes fail to synapse, and meiotic double-strand breaks are formed but are notefficiently repaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,137,329 W224* probably null Het
Aadacl3 A G 4: 144,455,869 V343A probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Arid2 A G 15: 96,372,205 T1400A probably benign Het
Arrdc1 G A 2: 24,926,405 T184I probably damaging Het
Aspm T C 1: 139,479,002 F1876L probably damaging Het
Calhm1 C T 19: 47,143,703 V158I probably benign Het
Caly T C 7: 140,070,397 K211E probably benign Het
Cenpe T C 3: 135,248,413 L1677P probably damaging Het
Cttnbp2 A G 6: 18,381,033 V1388A possibly damaging Het
Dgkd C T 1: 87,880,449 R80* probably null Het
Dnah3 A T 7: 119,978,222 I2072N probably damaging Het
Dnah8 A G 17: 30,690,261 I1020M probably benign Het
Drc3 T C 11: 60,393,821 V484A probably benign Het
Efcab8 A G 2: 153,780,992 D27G possibly damaging Het
Fat4 G A 3: 38,889,468 G837R probably damaging Het
Fgb A T 3: 83,046,176 C96S probably damaging Het
Flt4 G C 11: 49,626,686 W278C possibly damaging Het
Fmnl2 T C 2: 53,101,454 V327A probably damaging Het
Fras1 A T 5: 96,731,689 Y2455F possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm13872 T A 2: 102,737,909 I88N probably damaging Het
Hoxa6 A G 6: 52,208,414 S71P probably benign Het
Hunk T A 16: 90,453,739 C148S probably damaging Het
Ighv1-18 A C 12: 114,682,907 S26A probably damaging Het
Impg2 T G 16: 56,259,820 D553E possibly damaging Het
Ints1 A G 5: 139,772,145 I266T probably benign Het
Kpna3 G T 14: 61,403,014 T33K probably benign Het
Lamb1 A G 12: 31,299,931 D622G probably damaging Het
Lamp3 T C 16: 19,701,317 T39A probably damaging Het
Mnt C T 11: 74,843,078 probably benign Het
Msh4 A G 3: 153,867,840 S726P probably damaging Het
Olfr539 T A 7: 140,667,353 V22E probably benign Het
Pah A C 10: 87,567,347 K195Q probably damaging Het
Pdc T A 1: 150,333,500 *245K probably null Het
Pdzd8 A T 19: 59,300,540 H809Q possibly damaging Het
Plekhd1 A T 12: 80,722,366 I467L probably benign Het
Ppp2ca A G 11: 52,113,187 D57G probably damaging Het
Ralgapa1 A T 12: 55,820,766 M1K probably null Het
Rfx2 T A 17: 56,803,587 D133V probably benign Het
Scfd2 A T 5: 74,462,651 L407Q probably damaging Het
Scp2d1 T A 2: 144,824,037 S99T possibly damaging Het
Sec63 A T 10: 42,801,681 N261I probably damaging Het
Slc8a1 T C 17: 81,648,961 Y216C probably damaging Het
Son T A 16: 91,664,987 probably benign Het
Taar7a G T 10: 23,993,362 S40R probably benign Het
Ube3a A T 7: 59,276,059 D216V possibly damaging Het
Vgll2 A G 10: 52,027,563 D174G probably damaging Het
Vmn2r17 A T 5: 109,427,273 T149S possibly damaging Het
Zbtb39 G T 10: 127,742,688 C377F probably damaging Het
Zfp820 T A 17: 21,820,002 N115I probably damaging Het
Zfp948 T C 17: 21,584,816 S23P probably benign Het
Other mutations in Syce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02112:Syce1 APN 7 140779632 missense probably benign
IGL03304:Syce1 APN 7 140777710 missense possibly damaging 0.67
R0918:Syce1 UTSW 7 140780523 missense probably damaging 1.00
R1106:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R1169:Syce1 UTSW 7 140778207 missense probably benign 0.00
R1430:Syce1 UTSW 7 140779438 unclassified probably benign
R1436:Syce1 UTSW 7 140777680 missense possibly damaging 0.84
R1650:Syce1 UTSW 7 140778387 missense possibly damaging 0.62
R2081:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R2082:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R3890:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R3891:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4006:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4007:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4077:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4078:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4079:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R4817:Syce1 UTSW 7 140778423 missense probably benign 0.00
R4824:Syce1 UTSW 7 140779896 missense probably damaging 1.00
R5040:Syce1 UTSW 7 140779065 missense probably damaging 1.00
R6380:Syce1 UTSW 7 140779065 missense probably damaging 1.00
R7048:Syce1 UTSW 7 140779368 missense possibly damaging 0.73
Y4338:Syce1 UTSW 7 140779896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTTACACCTCTGCCTCAG -3'
(R):5'- TCAGGCAGATGTTCAAGGATG -3'

Sequencing Primer
(F):5'- TCAGCTGTGCCTCCTCAGAG -3'
(R):5'- TTCCTAGAGGCTGCAGCTCAG -3'
Posted On2016-11-21