Incidental Mutation 'V8831:Smoc1'
ID44628
Institutional Source Beutler Lab
Gene Symbol Smoc1
Ensembl Gene ENSMUSG00000021136
Gene NameSPARC related modular calcium binding 1
Synonyms2600002F22Rik, SPARC-related protein, SRG
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #V8831 () of strain 710
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location81026808-81186414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81168255 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 305 (D305G)
Ref Sequence ENSEMBL: ENSMUSP00000105976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021564] [ENSMUST00000110347] [ENSMUST00000129362]
Predicted Effect probably benign
Transcript: ENSMUST00000021564
AA Change: D294G

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021564
Gene: ENSMUSG00000021136
AA Change: D294G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
KAZAL 41 86 6.91e-8 SMART
TY 114 161 8.41e-12 SMART
TY 247 295 1.79e-15 SMART
Pfam:SPARC_Ca_bdg 311 423 1.6e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110347
AA Change: D305G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105976
Gene: ENSMUSG00000021136
AA Change: D305G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
KAZAL 41 86 6.91e-8 SMART
TY 114 161 8.41e-12 SMART
TY 258 306 1.79e-15 SMART
Pfam:SPARC_Ca_bdg 323 434 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129362
AA Change: D294G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122858
Gene: ENSMUSG00000021136
AA Change: D294G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
KAZAL 41 86 6.91e-8 SMART
TY 114 161 8.41e-12 SMART
TY 247 295 1.79e-15 SMART
Pfam:SPARC_Ca_bdg 311 423 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174932
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain secreted protein that may have a critical role in ocular and limb development. Mutations in this gene are associated with microphthalmia and limb anomalies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a transposon-induced allele exhibit ocular and limb defects. Mice homozygous for a knock-out allele exhibit neonatal lethality, osseous syndactyly, decreased body size, and iris and retina coloboma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsa1 A G 12: 87,269,923 N107S probably damaging Het
Arhgap23 A G 11: 97,456,545 I690V probably benign Het
Bard1 G A 1: 71,088,217 P78S probably damaging Het
Ccar1 G A 10: 62,747,406 T976I unknown Het
Cdc7 T A 5: 106,968,910 N50K probably benign Het
Cep85 C T 4: 134,156,069 E170K possibly damaging Het
Cpsf2 C T 12: 102,003,141 R757C probably damaging Het
Csmd3 A T 15: 48,457,696 D239E probably damaging Het
Dnah7b T G 1: 46,373,298 Y4022* probably null Het
Elmo3 A G 8: 105,307,061 N179S probably benign Het
H2-T24 T A 17: 36,017,324 Q89L probably damaging Het
Hist1h2bj G C 13: 22,043,281 probably benign Het
Irak4 T C 15: 94,561,484 I327T probably damaging Het
Itpr2 A T 6: 146,385,882 L157Q probably damaging Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lrrc72 G T 12: 36,208,657 T67K possibly damaging Het
Map2 T G 1: 66,415,845 I1298S probably damaging Het
Mroh2a T TN 1: 88,256,167 probably null Het
Ndst1 G A 18: 60,702,927 A428V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1369-ps1 T C 13: 21,116,003 Y104H possibly damaging Het
Olfr177 G T 16: 58,873,075 T25K probably benign Het
Olfr481 C T 7: 108,081,535 A247V probably benign Het
Plxna1 A G 6: 89,357,137 V170A probably damaging Het
Rfx6 G A 10: 51,718,208 probably null Het
Shprh G A 10: 11,186,862 D1238N probably damaging Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc9c1 A T 16: 45,577,899 I676F possibly damaging Het
Spdef C T 17: 27,718,077 R184H probably damaging Het
Stxbp4 C T 11: 90,480,671 A535T probably benign Het
Tcp11l1 C G 2: 104,685,484 V345L probably benign Het
Ticam1 TC T 17: 56,269,969 probably null Het
Ttc28 A T 5: 111,100,712 Y177F probably benign Het
Ugt2b34 A T 5: 86,906,674 Y83N probably benign Het
Vmn2r30 G A 7: 7,334,149 R163C probably benign Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Other mutations in Smoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Smoc1 APN 12 81152751 nonsense probably null
R1291:Smoc1 UTSW 12 81179591 missense probably damaging 0.97
R1902:Smoc1 UTSW 12 81104671 missense probably benign 0.32
R2109:Smoc1 UTSW 12 81150676 missense probably damaging 0.99
R2567:Smoc1 UTSW 12 81167590 missense probably damaging 0.99
R3900:Smoc1 UTSW 12 81167513 missense probably damaging 0.98
R4663:Smoc1 UTSW 12 81167602 missense probably damaging 1.00
R4762:Smoc1 UTSW 12 81167651 missense probably damaging 1.00
R4767:Smoc1 UTSW 12 81104773 critical splice donor site probably null
R4836:Smoc1 UTSW 12 81179548 missense probably damaging 1.00
R5264:Smoc1 UTSW 12 81104700 missense probably damaging 0.99
R5839:Smoc1 UTSW 12 81167585 missense probably damaging 1.00
R5898:Smoc1 UTSW 12 81104757 nonsense probably null
R7359:Smoc1 UTSW 12 81150701 missense probably damaging 1.00
R7611:Smoc1 UTSW 12 81179670 missense probably damaging 1.00
R7655:Smoc1 UTSW 12 81105908 missense possibly damaging 0.95
R7656:Smoc1 UTSW 12 81105908 missense possibly damaging 0.95
R8175:Smoc1 UTSW 12 81167666 missense probably damaging 0.97
Z1177:Smoc1 UTSW 12 81027150 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCGTGGTTAAAATGACATGCCTG -3'
(R):5'- GTCTGTGCTCCTATGATGAGCCTTC -3'

Sequencing Primer
(F):5'- GCCTGAACATGTCTCAATGG -3'
(R):5'- CTATGATGAGCCTTCCCAGC -3'
Posted On2013-06-11