Incidental Mutation 'R5766:Vgll2'
ID446284
Institutional Source Beutler Lab
Gene Symbol Vgll2
Ensembl Gene ENSMUSG00000049641
Gene Namevestigial like family member 2
SynonymsC130057C21Rik, Vito1, VITO-1, Vgl-2
MMRRC Submission 044424-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.775) question?
Stock #R5766 (G1)
Quality Score82
Status Not validated
Chromosome10
Chromosomal Location52022502-52028471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52027563 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 174 (D174G)
Ref Sequence ENSEMBL: ENSMUSP00000124091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058347] [ENSMUST00000163017]
Predicted Effect probably damaging
Transcript: ENSMUST00000058347
AA Change: D173G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050273
Gene: ENSMUSG00000049641
AA Change: D173G

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
Pfam:Vg_Tdu 78 110 7.6e-27 PFAM
low complexity region 192 204 N/A INTRINSIC
low complexity region 206 213 N/A INTRINSIC
low complexity region 245 262 N/A INTRINSIC
low complexity region 269 282 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163017
AA Change: D174G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124091
Gene: ENSMUSG00000049641
AA Change: D174G

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
Pfam:Vg_Tdu 78 108 1.1e-23 PFAM
low complexity region 193 205 N/A INTRINSIC
low complexity region 207 214 N/A INTRINSIC
low complexity region 246 263 N/A INTRINSIC
low complexity region 270 283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175173
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the Vestigial-like (Vgl) gene family and is upregulated during muscle differentiation. The product of this gene interacts with and modifies the DNA-binding properties of the transcription factor, TEF-1, and is important for muscle tissue development. Reduced expression of this gene leads to a reduction in the terminal differentiation of muscle cells. Alternate splicing results in multiple protein isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,137,329 W224* probably null Het
Aadacl3 A G 4: 144,455,869 V343A probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Arid2 A G 15: 96,372,205 T1400A probably benign Het
Arrdc1 G A 2: 24,926,405 T184I probably damaging Het
Aspm T C 1: 139,479,002 F1876L probably damaging Het
Calhm1 C T 19: 47,143,703 V158I probably benign Het
Caly T C 7: 140,070,397 K211E probably benign Het
Cenpe T C 3: 135,248,413 L1677P probably damaging Het
Cttnbp2 A G 6: 18,381,033 V1388A possibly damaging Het
Dgkd C T 1: 87,880,449 R80* probably null Het
Dnah3 A T 7: 119,978,222 I2072N probably damaging Het
Dnah8 A G 17: 30,690,261 I1020M probably benign Het
Drc3 T C 11: 60,393,821 V484A probably benign Het
Efcab8 A G 2: 153,780,992 D27G possibly damaging Het
Fat4 G A 3: 38,889,468 G837R probably damaging Het
Fgb A T 3: 83,046,176 C96S probably damaging Het
Flt4 G C 11: 49,626,686 W278C possibly damaging Het
Fmnl2 T C 2: 53,101,454 V327A probably damaging Het
Fras1 A T 5: 96,731,689 Y2455F possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm13872 T A 2: 102,737,909 I88N probably damaging Het
Hoxa6 A G 6: 52,208,414 S71P probably benign Het
Hunk T A 16: 90,453,739 C148S probably damaging Het
Ighv1-18 A C 12: 114,682,907 S26A probably damaging Het
Impg2 T G 16: 56,259,820 D553E possibly damaging Het
Ints1 A G 5: 139,772,145 I266T probably benign Het
Kpna3 G T 14: 61,403,014 T33K probably benign Het
Lamb1 A G 12: 31,299,931 D622G probably damaging Het
Lamp3 T C 16: 19,701,317 T39A probably damaging Het
Mnt C T 11: 74,843,078 probably benign Het
Msh4 A G 3: 153,867,840 S726P probably damaging Het
Olfr539 T A 7: 140,667,353 V22E probably benign Het
Pah A C 10: 87,567,347 K195Q probably damaging Het
Pdc T A 1: 150,333,500 *245K probably null Het
Pdzd8 A T 19: 59,300,540 H809Q possibly damaging Het
Plekhd1 A T 12: 80,722,366 I467L probably benign Het
Ppp2ca A G 11: 52,113,187 D57G probably damaging Het
Ralgapa1 A T 12: 55,820,766 M1K probably null Het
Rfx2 T A 17: 56,803,587 D133V probably benign Het
Scfd2 A T 5: 74,462,651 L407Q probably damaging Het
Scp2d1 T A 2: 144,824,037 S99T possibly damaging Het
Sec63 A T 10: 42,801,681 N261I probably damaging Het
Slc8a1 T C 17: 81,648,961 Y216C probably damaging Het
Son T A 16: 91,664,987 probably benign Het
Syce1 T C 7: 140,777,981 E285G probably damaging Het
Taar7a G T 10: 23,993,362 S40R probably benign Het
Ube3a A T 7: 59,276,059 D216V possibly damaging Het
Vmn2r17 A T 5: 109,427,273 T149S possibly damaging Het
Zbtb39 G T 10: 127,742,688 C377F probably damaging Het
Zfp820 T A 17: 21,820,002 N115I probably damaging Het
Zfp948 T C 17: 21,584,816 S23P probably benign Het
Other mutations in Vgll2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02436:Vgll2 APN 10 52025222 nonsense probably null
R1796:Vgll2 UTSW 10 52025228 missense probably damaging 1.00
R5193:Vgll2 UTSW 10 52027992 missense possibly damaging 0.96
R5397:Vgll2 UTSW 10 52025166 missense probably damaging 1.00
R5614:Vgll2 UTSW 10 52025222 nonsense probably null
R5842:Vgll2 UTSW 10 52025292 missense probably damaging 1.00
R7063:Vgll2 UTSW 10 52027976 missense probably benign 0.00
R7272:Vgll2 UTSW 10 52027662 missense possibly damaging 0.76
Z1176:Vgll2 UTSW 10 52027602 missense possibly damaging 0.94
Z1177:Vgll2 UTSW 10 52027808 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TCCTTAGAAGAGCACCCAGAGG -3'
(R):5'- TTACCTGAGTCCACGCTGAG -3'

Sequencing Primer
(F):5'- CACTGACTGCCGTGACACTC -3'
(R):5'- ATGAGCAGCGGCCCATAG -3'
Posted On2016-11-21