Incidental Mutation 'R5766:Flt4'
ID446287
Institutional Source Beutler Lab
Gene Symbol Flt4
Ensembl Gene ENSMUSG00000020357
Gene NameFMS-like tyrosine kinase 4
SynonymsVEGFR-3, Flt-4, VEGFR3
MMRRC Submission 044424-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5766 (G1)
Quality Score185
Status Not validated
Chromosome11
Chromosomal Location49609263-49652739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 49626686 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 278 (W278C)
Ref Sequence ENSEMBL: ENSMUSP00000020617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020617
AA Change: W278C

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020617
Gene: ENSMUSG00000020357
AA Change: W278C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 36 133 3.73e0 SMART
IG 237 328 3.15e-10 SMART
IG 341 419 4.5e0 SMART
IG 430 552 8.46e-2 SMART
IGc2 569 660 1.29e-6 SMART
IGc2 690 755 2.48e-17 SMART
transmembrane domain 776 798 N/A INTRINSIC
TyrKc 845 1169 2.2e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152253
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase receptor for vascular endothelial growth factors C and D. The protein is thought to be involved in lymphangiogenesis and maintenance of the lymphatic endothelium. Mutations in this gene cause hereditary lymphedema type IA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a targeted null mutation show growth retardation, vascular abnormalities, severe anemia and die from cardiovascular failure at embryonic day 9.5. Heterozygotes for another mutation show abdominal chylous ascites, abnormal lymphaticvessels, and lymphedema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,137,329 W224* probably null Het
Aadacl3 A G 4: 144,455,869 V343A probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Arid2 A G 15: 96,372,205 T1400A probably benign Het
Arrdc1 G A 2: 24,926,405 T184I probably damaging Het
Aspm T C 1: 139,479,002 F1876L probably damaging Het
Calhm1 C T 19: 47,143,703 V158I probably benign Het
Caly T C 7: 140,070,397 K211E probably benign Het
Cenpe T C 3: 135,248,413 L1677P probably damaging Het
Cttnbp2 A G 6: 18,381,033 V1388A possibly damaging Het
Dgkd C T 1: 87,880,449 R80* probably null Het
Dnah3 A T 7: 119,978,222 I2072N probably damaging Het
Dnah8 A G 17: 30,690,261 I1020M probably benign Het
Drc3 T C 11: 60,393,821 V484A probably benign Het
Efcab8 A G 2: 153,780,992 D27G possibly damaging Het
Fat4 G A 3: 38,889,468 G837R probably damaging Het
Fgb A T 3: 83,046,176 C96S probably damaging Het
Fmnl2 T C 2: 53,101,454 V327A probably damaging Het
Fras1 A T 5: 96,731,689 Y2455F possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm13872 T A 2: 102,737,909 I88N probably damaging Het
Hoxa6 A G 6: 52,208,414 S71P probably benign Het
Hunk T A 16: 90,453,739 C148S probably damaging Het
Ighv1-18 A C 12: 114,682,907 S26A probably damaging Het
Impg2 T G 16: 56,259,820 D553E possibly damaging Het
Ints1 A G 5: 139,772,145 I266T probably benign Het
Kpna3 G T 14: 61,403,014 T33K probably benign Het
Lamb1 A G 12: 31,299,931 D622G probably damaging Het
Lamp3 T C 16: 19,701,317 T39A probably damaging Het
Mnt C T 11: 74,843,078 probably benign Het
Msh4 A G 3: 153,867,840 S726P probably damaging Het
Olfr539 T A 7: 140,667,353 V22E probably benign Het
Pah A C 10: 87,567,347 K195Q probably damaging Het
Pdc T A 1: 150,333,500 *245K probably null Het
Pdzd8 A T 19: 59,300,540 H809Q possibly damaging Het
Plekhd1 A T 12: 80,722,366 I467L probably benign Het
Ppp2ca A G 11: 52,113,187 D57G probably damaging Het
Ralgapa1 A T 12: 55,820,766 M1K probably null Het
Rfx2 T A 17: 56,803,587 D133V probably benign Het
Scfd2 A T 5: 74,462,651 L407Q probably damaging Het
Scp2d1 T A 2: 144,824,037 S99T possibly damaging Het
Sec63 A T 10: 42,801,681 N261I probably damaging Het
Slc8a1 T C 17: 81,648,961 Y216C probably damaging Het
Son T A 16: 91,664,987 probably benign Het
Syce1 T C 7: 140,777,981 E285G probably damaging Het
Taar7a G T 10: 23,993,362 S40R probably benign Het
Ube3a A T 7: 59,276,059 D216V possibly damaging Het
Vgll2 A G 10: 52,027,563 D174G probably damaging Het
Vmn2r17 A T 5: 109,427,273 T149S possibly damaging Het
Zbtb39 G T 10: 127,742,688 C377F probably damaging Het
Zfp820 T A 17: 21,820,002 N115I probably damaging Het
Zfp948 T C 17: 21,584,816 S23P probably benign Het
Other mutations in Flt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Flt4 APN 11 49635261 missense probably damaging 1.00
IGL01140:Flt4 APN 11 49634943 nonsense probably null
IGL01360:Flt4 APN 11 49643506 missense probably benign 0.04
IGL01386:Flt4 APN 11 49637335 missense probably benign 0.00
IGL01769:Flt4 APN 11 49635171 splice site probably benign
IGL02189:Flt4 APN 11 49626003 missense probably damaging 1.00
IGL02206:Flt4 APN 11 49630390 missense probably damaging 0.98
IGL02324:Flt4 APN 11 49645995 missense probably benign 0.13
IGL02433:Flt4 APN 11 49630573 missense probably benign 0.01
IGL03009:Flt4 APN 11 49627124 missense probably benign 0.02
IGL03035:Flt4 APN 11 49645897 nonsense probably null
IGL03059:Flt4 APN 11 49642307 missense probably damaging 0.97
IGL03350:Flt4 APN 11 49634793 nonsense probably null
PIT4802001:Flt4 UTSW 11 49633169 missense probably benign
R0360:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0364:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0386:Flt4 UTSW 11 49644386 missense probably benign 0.00
R0395:Flt4 UTSW 11 49630343 missense probably benign 0.00
R0600:Flt4 UTSW 11 49636339 splice site probably benign
R0666:Flt4 UTSW 11 49625447 missense possibly damaging 0.53
R0720:Flt4 UTSW 11 49636339 splice site probably benign
R0734:Flt4 UTSW 11 49626717 missense possibly damaging 0.67
R0973:Flt4 UTSW 11 49636339 splice site probably benign
R1013:Flt4 UTSW 11 49636339 splice site probably benign
R1103:Flt4 UTSW 11 49636339 splice site probably benign
R1104:Flt4 UTSW 11 49636339 splice site probably benign
R1162:Flt4 UTSW 11 49636339 splice site probably benign
R1241:Flt4 UTSW 11 49636339 splice site probably benign
R1401:Flt4 UTSW 11 49636339 splice site probably benign
R1487:Flt4 UTSW 11 49633144 missense possibly damaging 0.86
R1546:Flt4 UTSW 11 49631981 missense probably benign 0.03
R1999:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2110:Flt4 UTSW 11 49625304 missense probably benign 0.03
R2150:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2189:Flt4 UTSW 11 49635698 missense probably benign 0.24
R2217:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2218:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2249:Flt4 UTSW 11 49645959 missense possibly damaging 0.66
R2402:Flt4 UTSW 11 49637819 missense possibly damaging 0.82
R3508:Flt4 UTSW 11 49634114 missense probably damaging 0.99
R3974:Flt4 UTSW 11 49636740 missense probably damaging 0.99
R4168:Flt4 UTSW 11 49630573 missense probably benign 0.01
R4700:Flt4 UTSW 11 49626444 intron probably benign
R4701:Flt4 UTSW 11 49626808 missense possibly damaging 0.49
R4714:Flt4 UTSW 11 49627207 missense probably damaging 0.99
R4817:Flt4 UTSW 11 49625415 missense probably damaging 0.98
R4921:Flt4 UTSW 11 49627143 missense probably damaging 0.98
R5066:Flt4 UTSW 11 49634163 missense possibly damaging 0.62
R5095:Flt4 UTSW 11 49627159 missense possibly damaging 0.95
R5166:Flt4 UTSW 11 49633257 splice site probably null
R5245:Flt4 UTSW 11 49651034 frame shift probably null
R5250:Flt4 UTSW 11 49630400 missense possibly damaging 0.88
R5400:Flt4 UTSW 11 49651034 frame shift probably null
R5401:Flt4 UTSW 11 49651034 frame shift probably null
R5402:Flt4 UTSW 11 49651034 frame shift probably null
R5527:Flt4 UTSW 11 49634754 missense probably damaging 1.00
R5686:Flt4 UTSW 11 49630603 missense probably benign 0.00
R5996:Flt4 UTSW 11 49651070 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6352:Flt4 UTSW 11 49643506 missense probably benign 0.04
R6361:Flt4 UTSW 11 49630578 missense probably benign 0.00
R6574:Flt4 UTSW 11 49625372 missense probably benign
R7205:Flt4 UTSW 11 49634298 missense probably null 0.78
R7216:Flt4 UTSW 11 49634681 missense possibly damaging 0.73
R7257:Flt4 UTSW 11 49626009 missense probably benign 0.22
R7457:Flt4 UTSW 11 49630328 missense possibly damaging 0.89
R7559:Flt4 UTSW 11 49644371 missense possibly damaging 0.50
X0017:Flt4 UTSW 11 49626733 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACAGACTCAGTAACCCAAGTGATG -3'
(R):5'- AGGTTCCATGAAACCGGACC -3'

Sequencing Primer
(F):5'- GGATGGGGAAGTTTTCTATACCAAAG -3'
(R):5'- GCACAGTGACCTCAGCCTC -3'
Posted On2016-11-21