Incidental Mutation 'R5766:Lamb1'
ID 446294
Institutional Source Beutler Lab
Gene Symbol Lamb1
Ensembl Gene ENSMUSG00000002900
Gene Name laminin B1
Synonyms Lamb-1, D130003D08Rik, C80098, C81607, Lamb1-1
MMRRC Submission 044424-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5766 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 31315233-31379643 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31349930 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 622 (D622G)
Ref Sequence ENSEMBL: ENSMUSP00000132778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002979] [ENSMUST00000169088]
AlphaFold P02469
PDB Structure Laminin beta1 LN-LE1-4 structure [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000002979
AA Change: D670G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000002979
Gene: ENSMUSG00000002900
AA Change: D670G

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
LamNT 77 317 3.24e-96 SMART
EGF_Lam 319 380 1.34e-6 SMART
EGF_Lam 383 443 1.33e-10 SMART
EGF_Lam 446 503 2.89e-11 SMART
EGF_Lam 506 555 2.89e-11 SMART
EGF_Lam 558 602 3.4e-8 SMART
EGF_Lam 821 866 4.99e-15 SMART
EGF_Lam 869 912 2.38e-12 SMART
EGF_Lam 915 962 2.4e-8 SMART
EGF_Lam 965 1021 1.41e-5 SMART
EGF_Lam 1024 1073 4.81e-8 SMART
EGF_Lam 1076 1129 3.81e-11 SMART
EGF_Lam 1132 1177 5.61e-9 SMART
EGF_Lam 1180 1224 2.89e-11 SMART
coiled coil region 1329 1360 N/A INTRINSIC
low complexity region 1468 1480 N/A INTRINSIC
coiled coil region 1497 1551 N/A INTRINSIC
coiled coil region 1600 1826 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169088
AA Change: D622G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132778
Gene: ENSMUSG00000002900
AA Change: D622G

DomainStartEndE-ValueType
LamNT 29 269 3.24e-96 SMART
EGF_Lam 271 332 1.34e-6 SMART
EGF_Lam 335 395 1.33e-10 SMART
EGF_Lam 398 455 2.89e-11 SMART
EGF_Lam 458 507 2.89e-11 SMART
EGF_Lam 510 554 3.4e-8 SMART
EGF_Lam 773 818 4.99e-15 SMART
EGF_Lam 821 864 2.38e-12 SMART
EGF_Lam 867 914 2.4e-8 SMART
EGF_Lam 917 973 1.41e-5 SMART
EGF_Lam 976 1025 4.81e-8 SMART
EGF_Lam 1028 1081 3.81e-11 SMART
EGF_Lam 1084 1129 5.61e-9 SMART
EGF_Lam 1132 1176 2.89e-11 SMART
coiled coil region 1281 1312 N/A INTRINSIC
low complexity region 1420 1432 N/A INTRINSIC
coiled coil region 1449 1503 N/A INTRINSIC
coiled coil region 1552 1778 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 1. The beta 1 chain has 7 structurally distinct domains which it shares with other beta chain isomers. The C-terminal helical region containing domains I and II are separated by domain alpha, domains III and V contain several EGF-like repeats, and domains IV and VI have a globular conformation. Laminin, beta 1 is expressed in most tissues that produce basement membranes, and is one of the 3 chains constituting laminin 1, the first laminin isolated from Engelbreth-Holm-Swarm (EHS) tumor. A sequence in the beta 1 chain that is involved in cell attachment, chemotaxis, and binding to the laminin receptor was identified and shown to have the capacity to inhibit metastasis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a gene trapped allele lack basement membranes and fail to survive past E5.5. Mice heterozygous for a spontaneous mutation exhibit dystonis with impaired neuron firing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A G 4: 144,182,439 (GRCm39) V343A probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 37,461,383 (GRCm39) probably null Het
Arid2 A G 15: 96,270,086 (GRCm39) T1400A probably benign Het
Arrdc1 G A 2: 24,816,417 (GRCm39) T184I probably damaging Het
Aspm T C 1: 139,406,740 (GRCm39) F1876L probably damaging Het
Calhm1 C T 19: 47,132,142 (GRCm39) V158I probably benign Het
Caly T C 7: 139,650,310 (GRCm39) K211E probably benign Het
Cenpe T C 3: 134,954,174 (GRCm39) L1677P probably damaging Het
Cttnbp2 A G 6: 18,381,032 (GRCm39) V1388A possibly damaging Het
Dgkd C T 1: 87,808,171 (GRCm39) R80* probably null Het
Dnah3 A T 7: 119,577,445 (GRCm39) I2072N probably damaging Het
Dnah8 A G 17: 30,909,235 (GRCm39) I1020M probably benign Het
Drc3 T C 11: 60,284,647 (GRCm39) V484A probably benign Het
Efcab8 A G 2: 153,622,912 (GRCm39) D27G possibly damaging Het
Fat4 G A 3: 38,943,617 (GRCm39) G837R probably damaging Het
Fcgbpl1 G A 7: 27,836,754 (GRCm39) W224* probably null Het
Fgb A T 3: 82,953,483 (GRCm39) C96S probably damaging Het
Flt4 G C 11: 49,517,513 (GRCm39) W278C possibly damaging Het
Fmnl2 T C 2: 52,991,466 (GRCm39) V327A probably damaging Het
Fras1 A T 5: 96,879,548 (GRCm39) Y2455F possibly damaging Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm13872 T A 2: 102,568,254 (GRCm39) I88N probably damaging Het
Hoxa6 A G 6: 52,185,394 (GRCm39) S71P probably benign Het
Hunk T A 16: 90,250,627 (GRCm39) C148S probably damaging Het
Ighv1-18 A C 12: 114,646,527 (GRCm39) S26A probably damaging Het
Impg2 T G 16: 56,080,183 (GRCm39) D553E possibly damaging Het
Ints1 A G 5: 139,757,900 (GRCm39) I266T probably benign Het
Kpna3 G T 14: 61,640,463 (GRCm39) T33K probably benign Het
Lamp3 T C 16: 19,520,067 (GRCm39) T39A probably damaging Het
Mnt C T 11: 74,733,904 (GRCm39) probably benign Het
Msh4 A G 3: 153,573,477 (GRCm39) S726P probably damaging Het
Or13a25 T A 7: 140,247,266 (GRCm39) V22E probably benign Het
Pah A C 10: 87,403,209 (GRCm39) K195Q probably damaging Het
Pdc T A 1: 150,209,251 (GRCm39) *245K probably null Het
Pdzd8 A T 19: 59,288,972 (GRCm39) H809Q possibly damaging Het
Plekhd1 A T 12: 80,769,140 (GRCm39) I467L probably benign Het
Ppp2ca A G 11: 52,004,014 (GRCm39) D57G probably damaging Het
Ralgapa1 A T 12: 55,867,551 (GRCm39) M1K probably null Het
Rfx2 T A 17: 57,110,587 (GRCm39) D133V probably benign Het
Scfd2 A T 5: 74,623,312 (GRCm39) L407Q probably damaging Het
Scp2d1 T A 2: 144,665,957 (GRCm39) S99T possibly damaging Het
Sec63 A T 10: 42,677,677 (GRCm39) N261I probably damaging Het
Slc8a1 T C 17: 81,956,390 (GRCm39) Y216C probably damaging Het
Son T A 16: 91,461,875 (GRCm39) probably benign Het
Syce1 T C 7: 140,357,894 (GRCm39) E285G probably damaging Het
Taar7a G T 10: 23,869,260 (GRCm39) S40R probably benign Het
Ube3a A T 7: 58,925,807 (GRCm39) D216V possibly damaging Het
Vgll2 A G 10: 51,903,659 (GRCm39) D174G probably damaging Het
Vmn2r17 A T 5: 109,575,139 (GRCm39) T149S possibly damaging Het
Zbtb39 G T 10: 127,578,557 (GRCm39) C377F probably damaging Het
Zfp820 T A 17: 22,038,983 (GRCm39) N115I probably damaging Het
Zfp948 T C 17: 21,805,078 (GRCm39) S23P probably benign Het
Other mutations in Lamb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Lamb1 APN 12 31,348,825 (GRCm39) missense possibly damaging 0.74
IGL00939:Lamb1 APN 12 31,352,926 (GRCm39) missense probably damaging 1.00
IGL01017:Lamb1 APN 12 31,351,063 (GRCm39) missense possibly damaging 0.89
IGL01384:Lamb1 APN 12 31,370,930 (GRCm39) missense probably benign 0.09
IGL01470:Lamb1 APN 12 31,350,261 (GRCm39) missense possibly damaging 0.55
IGL01554:Lamb1 APN 12 31,356,976 (GRCm39) missense probably damaging 1.00
IGL02207:Lamb1 APN 12 31,379,434 (GRCm39) missense probably damaging 1.00
IGL02271:Lamb1 APN 12 31,350,250 (GRCm39) missense probably damaging 1.00
IGL02272:Lamb1 APN 12 31,355,768 (GRCm39) missense probably benign 0.00
IGL02365:Lamb1 APN 12 31,368,344 (GRCm39) missense probably damaging 1.00
IGL02471:Lamb1 APN 12 31,370,907 (GRCm39) missense probably damaging 1.00
IGL02704:Lamb1 APN 12 31,368,466 (GRCm39) missense probably benign 0.05
IGL03132:Lamb1 APN 12 31,350,333 (GRCm39) splice site probably null
IGL03161:Lamb1 APN 12 31,376,255 (GRCm39) missense probably benign 0.41
IGL03169:Lamb1 APN 12 31,373,645 (GRCm39) missense probably damaging 1.00
Crush UTSW 12 31,337,423 (GRCm39) missense probably damaging 1.00
Deflationary UTSW 12 31,371,074 (GRCm39) missense probably null 0.63
E0374:Lamb1 UTSW 12 31,337,929 (GRCm39) missense probably damaging 1.00
P0043:Lamb1 UTSW 12 31,328,620 (GRCm39) missense probably damaging 1.00
R0031:Lamb1 UTSW 12 31,351,155 (GRCm39) missense probably benign 0.04
R0047:Lamb1 UTSW 12 31,328,600 (GRCm39) missense possibly damaging 0.51
R0047:Lamb1 UTSW 12 31,328,600 (GRCm39) missense possibly damaging 0.51
R0285:Lamb1 UTSW 12 31,376,644 (GRCm39) nonsense probably null
R0456:Lamb1 UTSW 12 31,354,729 (GRCm39) missense probably damaging 1.00
R0477:Lamb1 UTSW 12 31,376,268 (GRCm39) missense possibly damaging 0.47
R0480:Lamb1 UTSW 12 31,332,720 (GRCm39) missense possibly damaging 0.79
R0544:Lamb1 UTSW 12 31,332,694 (GRCm39) missense probably damaging 1.00
R0565:Lamb1 UTSW 12 31,348,914 (GRCm39) missense probably benign 0.02
R1500:Lamb1 UTSW 12 31,348,948 (GRCm39) missense possibly damaging 0.82
R1624:Lamb1 UTSW 12 31,328,651 (GRCm39) critical splice donor site probably null
R1772:Lamb1 UTSW 12 31,328,524 (GRCm39) missense probably damaging 1.00
R1836:Lamb1 UTSW 12 31,351,093 (GRCm39) missense probably benign 0.00
R1853:Lamb1 UTSW 12 31,368,271 (GRCm39) missense probably damaging 1.00
R1854:Lamb1 UTSW 12 31,368,271 (GRCm39) missense probably damaging 1.00
R1903:Lamb1 UTSW 12 31,379,209 (GRCm39) missense probably damaging 1.00
R2091:Lamb1 UTSW 12 31,337,428 (GRCm39) missense probably damaging 0.98
R2186:Lamb1 UTSW 12 31,368,466 (GRCm39) nonsense probably null
R2268:Lamb1 UTSW 12 31,377,644 (GRCm39) missense probably damaging 1.00
R2567:Lamb1 UTSW 12 31,319,054 (GRCm39) critical splice acceptor site probably null
R2698:Lamb1 UTSW 12 31,348,882 (GRCm39) missense probably benign 0.10
R3121:Lamb1 UTSW 12 31,337,528 (GRCm39) missense probably damaging 1.00
R3405:Lamb1 UTSW 12 31,337,528 (GRCm39) missense probably damaging 1.00
R3406:Lamb1 UTSW 12 31,337,528 (GRCm39) missense probably damaging 1.00
R3608:Lamb1 UTSW 12 31,337,909 (GRCm39) missense probably damaging 1.00
R3725:Lamb1 UTSW 12 31,371,074 (GRCm39) missense probably null 0.63
R3726:Lamb1 UTSW 12 31,371,074 (GRCm39) missense probably null 0.63
R3949:Lamb1 UTSW 12 31,332,648 (GRCm39) missense probably damaging 1.00
R4308:Lamb1 UTSW 12 31,379,254 (GRCm39) missense probably damaging 1.00
R4600:Lamb1 UTSW 12 31,373,528 (GRCm39) missense probably benign 0.00
R4604:Lamb1 UTSW 12 31,328,775 (GRCm39) missense probably damaging 1.00
R4701:Lamb1 UTSW 12 31,316,847 (GRCm39) nonsense probably null
R4710:Lamb1 UTSW 12 31,332,582 (GRCm39) missense probably benign 0.02
R4767:Lamb1 UTSW 12 31,358,010 (GRCm39) missense probably damaging 1.00
R4809:Lamb1 UTSW 12 31,328,525 (GRCm39) missense probably damaging 1.00
R4828:Lamb1 UTSW 12 31,348,929 (GRCm39) missense probably benign
R4842:Lamb1 UTSW 12 31,337,432 (GRCm39) missense probably damaging 1.00
R4864:Lamb1 UTSW 12 31,371,005 (GRCm39) missense probably benign 0.01
R4909:Lamb1 UTSW 12 31,338,280 (GRCm39) missense probably damaging 1.00
R4989:Lamb1 UTSW 12 31,376,677 (GRCm39) missense probably damaging 1.00
R5444:Lamb1 UTSW 12 31,348,908 (GRCm39) missense possibly damaging 0.47
R5736:Lamb1 UTSW 12 31,352,664 (GRCm39) nonsense probably null
R5825:Lamb1 UTSW 12 31,368,613 (GRCm39) missense probably benign
R5840:Lamb1 UTSW 12 31,316,755 (GRCm39) missense probably damaging 1.00
R5867:Lamb1 UTSW 12 31,348,954 (GRCm39) missense possibly damaging 0.82
R5887:Lamb1 UTSW 12 31,316,863 (GRCm39) nonsense probably null
R5984:Lamb1 UTSW 12 31,377,773 (GRCm39) missense possibly damaging 0.76
R6313:Lamb1 UTSW 12 31,319,146 (GRCm39) missense probably damaging 1.00
R6359:Lamb1 UTSW 12 31,332,715 (GRCm39) missense probably damaging 0.97
R6505:Lamb1 UTSW 12 31,373,461 (GRCm39) missense possibly damaging 0.63
R7127:Lamb1 UTSW 12 31,374,314 (GRCm39) missense probably damaging 1.00
R7202:Lamb1 UTSW 12 31,374,314 (GRCm39) missense probably damaging 1.00
R7271:Lamb1 UTSW 12 31,337,423 (GRCm39) missense probably damaging 1.00
R7290:Lamb1 UTSW 12 31,315,595 (GRCm39) missense probably benign 0.04
R7486:Lamb1 UTSW 12 31,337,441 (GRCm39) missense probably benign 0.00
R7496:Lamb1 UTSW 12 31,350,020 (GRCm39) missense probably benign 0.31
R7591:Lamb1 UTSW 12 31,376,647 (GRCm39) missense probably damaging 1.00
R7722:Lamb1 UTSW 12 31,373,570 (GRCm39) missense probably damaging 0.99
R7985:Lamb1 UTSW 12 31,350,214 (GRCm39) missense possibly damaging 0.93
R8058:Lamb1 UTSW 12 31,353,046 (GRCm39) missense probably benign 0.16
R8353:Lamb1 UTSW 12 31,356,998 (GRCm39) missense probably damaging 1.00
R8506:Lamb1 UTSW 12 31,379,360 (GRCm39) missense probably damaging 1.00
R8846:Lamb1 UTSW 12 31,379,388 (GRCm39) missense possibly damaging 0.75
R8888:Lamb1 UTSW 12 31,352,953 (GRCm39) missense possibly damaging 0.95
R8895:Lamb1 UTSW 12 31,352,953 (GRCm39) missense possibly damaging 0.95
R9312:Lamb1 UTSW 12 31,368,352 (GRCm39) missense probably damaging 1.00
R9340:Lamb1 UTSW 12 31,374,224 (GRCm39) missense probably benign
R9340:Lamb1 UTSW 12 31,374,223 (GRCm39) missense probably benign
R9371:Lamb1 UTSW 12 31,348,863 (GRCm39) missense probably damaging 0.98
R9417:Lamb1 UTSW 12 31,337,983 (GRCm39) missense probably damaging 1.00
R9562:Lamb1 UTSW 12 31,322,492 (GRCm39) missense probably damaging 1.00
R9626:Lamb1 UTSW 12 31,354,669 (GRCm39) missense probably benign
R9641:Lamb1 UTSW 12 31,337,457 (GRCm39) missense probably damaging 0.97
X0054:Lamb1 UTSW 12 31,337,433 (GRCm39) missense probably damaging 1.00
X0064:Lamb1 UTSW 12 31,353,041 (GRCm39) missense probably benign 0.35
Z1176:Lamb1 UTSW 12 31,377,701 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AAAGGCTGTCTTGAGCAGG -3'
(R):5'- AACAGAGGGCCTTCCATAGC -3'

Sequencing Primer
(F):5'- TTCCGTGAGCCTTACCGG -3'
(R):5'- TAGCCAGTGACTCAGTCTCTAAG -3'
Posted On 2016-11-21