Incidental Mutation 'R5766:Lamb1'
ID 446294
Institutional Source Beutler Lab
Gene Symbol Lamb1
Ensembl Gene ENSMUSG00000002900
Gene Name laminin B1
Synonyms C80098, C81607, Lamb1-1, Lamb-1, D130003D08Rik
MMRRC Submission 044424-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5766 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 31265234-31329644 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31299931 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 622 (D622G)
Ref Sequence ENSEMBL: ENSMUSP00000132778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002979] [ENSMUST00000169088]
AlphaFold P02469
PDB Structure Laminin beta1 LN-LE1-4 structure [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000002979
AA Change: D670G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000002979
Gene: ENSMUSG00000002900
AA Change: D670G

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
LamNT 77 317 3.24e-96 SMART
EGF_Lam 319 380 1.34e-6 SMART
EGF_Lam 383 443 1.33e-10 SMART
EGF_Lam 446 503 2.89e-11 SMART
EGF_Lam 506 555 2.89e-11 SMART
EGF_Lam 558 602 3.4e-8 SMART
EGF_Lam 821 866 4.99e-15 SMART
EGF_Lam 869 912 2.38e-12 SMART
EGF_Lam 915 962 2.4e-8 SMART
EGF_Lam 965 1021 1.41e-5 SMART
EGF_Lam 1024 1073 4.81e-8 SMART
EGF_Lam 1076 1129 3.81e-11 SMART
EGF_Lam 1132 1177 5.61e-9 SMART
EGF_Lam 1180 1224 2.89e-11 SMART
coiled coil region 1329 1360 N/A INTRINSIC
low complexity region 1468 1480 N/A INTRINSIC
coiled coil region 1497 1551 N/A INTRINSIC
coiled coil region 1600 1826 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169088
AA Change: D622G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132778
Gene: ENSMUSG00000002900
AA Change: D622G

DomainStartEndE-ValueType
LamNT 29 269 3.24e-96 SMART
EGF_Lam 271 332 1.34e-6 SMART
EGF_Lam 335 395 1.33e-10 SMART
EGF_Lam 398 455 2.89e-11 SMART
EGF_Lam 458 507 2.89e-11 SMART
EGF_Lam 510 554 3.4e-8 SMART
EGF_Lam 773 818 4.99e-15 SMART
EGF_Lam 821 864 2.38e-12 SMART
EGF_Lam 867 914 2.4e-8 SMART
EGF_Lam 917 973 1.41e-5 SMART
EGF_Lam 976 1025 4.81e-8 SMART
EGF_Lam 1028 1081 3.81e-11 SMART
EGF_Lam 1084 1129 5.61e-9 SMART
EGF_Lam 1132 1176 2.89e-11 SMART
coiled coil region 1281 1312 N/A INTRINSIC
low complexity region 1420 1432 N/A INTRINSIC
coiled coil region 1449 1503 N/A INTRINSIC
coiled coil region 1552 1778 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 1. The beta 1 chain has 7 structurally distinct domains which it shares with other beta chain isomers. The C-terminal helical region containing domains I and II are separated by domain alpha, domains III and V contain several EGF-like repeats, and domains IV and VI have a globular conformation. Laminin, beta 1 is expressed in most tissues that produce basement membranes, and is one of the 3 chains constituting laminin 1, the first laminin isolated from Engelbreth-Holm-Swarm (EHS) tumor. A sequence in the beta 1 chain that is involved in cell attachment, chemotaxis, and binding to the laminin receptor was identified and shown to have the capacity to inhibit metastasis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a gene trapped allele lack basement membranes and fail to survive past E5.5. Mice heterozygous for a spontaneous mutation exhibit dystonis with impaired neuron firing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,137,329 W224* probably null Het
Aadacl3 A G 4: 144,455,869 V343A probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Arid2 A G 15: 96,372,205 T1400A probably benign Het
Arrdc1 G A 2: 24,926,405 T184I probably damaging Het
Aspm T C 1: 139,479,002 F1876L probably damaging Het
Calhm1 C T 19: 47,143,703 V158I probably benign Het
Caly T C 7: 140,070,397 K211E probably benign Het
Cenpe T C 3: 135,248,413 L1677P probably damaging Het
Cttnbp2 A G 6: 18,381,033 V1388A possibly damaging Het
Dgkd C T 1: 87,880,449 R80* probably null Het
Dnah3 A T 7: 119,978,222 I2072N probably damaging Het
Dnah8 A G 17: 30,690,261 I1020M probably benign Het
Drc3 T C 11: 60,393,821 V484A probably benign Het
Efcab8 A G 2: 153,780,992 D27G possibly damaging Het
Fat4 G A 3: 38,889,468 G837R probably damaging Het
Fgb A T 3: 83,046,176 C96S probably damaging Het
Flt4 G C 11: 49,626,686 W278C possibly damaging Het
Fmnl2 T C 2: 53,101,454 V327A probably damaging Het
Fras1 A T 5: 96,731,689 Y2455F possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm13872 T A 2: 102,737,909 I88N probably damaging Het
Hoxa6 A G 6: 52,208,414 S71P probably benign Het
Hunk T A 16: 90,453,739 C148S probably damaging Het
Ighv1-18 A C 12: 114,682,907 S26A probably damaging Het
Impg2 T G 16: 56,259,820 D553E possibly damaging Het
Ints1 A G 5: 139,772,145 I266T probably benign Het
Kpna3 G T 14: 61,403,014 T33K probably benign Het
Lamp3 T C 16: 19,701,317 T39A probably damaging Het
Mnt C T 11: 74,843,078 probably benign Het
Msh4 A G 3: 153,867,840 S726P probably damaging Het
Olfr539 T A 7: 140,667,353 V22E probably benign Het
Pah A C 10: 87,567,347 K195Q probably damaging Het
Pdc T A 1: 150,333,500 *245K probably null Het
Pdzd8 A T 19: 59,300,540 H809Q possibly damaging Het
Plekhd1 A T 12: 80,722,366 I467L probably benign Het
Ppp2ca A G 11: 52,113,187 D57G probably damaging Het
Ralgapa1 A T 12: 55,820,766 M1K probably null Het
Rfx2 T A 17: 56,803,587 D133V probably benign Het
Scfd2 A T 5: 74,462,651 L407Q probably damaging Het
Scp2d1 T A 2: 144,824,037 S99T possibly damaging Het
Sec63 A T 10: 42,801,681 N261I probably damaging Het
Slc8a1 T C 17: 81,648,961 Y216C probably damaging Het
Son T A 16: 91,664,987 probably benign Het
Syce1 T C 7: 140,777,981 E285G probably damaging Het
Taar7a G T 10: 23,993,362 S40R probably benign Het
Ube3a A T 7: 59,276,059 D216V possibly damaging Het
Vgll2 A G 10: 52,027,563 D174G probably damaging Het
Vmn2r17 A T 5: 109,427,273 T149S possibly damaging Het
Zbtb39 G T 10: 127,742,688 C377F probably damaging Het
Zfp820 T A 17: 21,820,002 N115I probably damaging Het
Zfp948 T C 17: 21,584,816 S23P probably benign Het
Other mutations in Lamb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Lamb1 APN 12 31298826 missense possibly damaging 0.74
IGL00939:Lamb1 APN 12 31302927 missense probably damaging 1.00
IGL01017:Lamb1 APN 12 31301064 missense possibly damaging 0.89
IGL01384:Lamb1 APN 12 31320931 missense probably benign 0.09
IGL01470:Lamb1 APN 12 31300262 missense possibly damaging 0.55
IGL01554:Lamb1 APN 12 31306977 missense probably damaging 1.00
IGL02207:Lamb1 APN 12 31329435 missense probably damaging 1.00
IGL02271:Lamb1 APN 12 31300251 missense probably damaging 1.00
IGL02272:Lamb1 APN 12 31305769 missense probably benign 0.00
IGL02365:Lamb1 APN 12 31318345 missense probably damaging 1.00
IGL02471:Lamb1 APN 12 31320908 missense probably damaging 1.00
IGL02704:Lamb1 APN 12 31318467 missense probably benign 0.05
IGL03132:Lamb1 APN 12 31300334 splice site probably null
IGL03161:Lamb1 APN 12 31326256 missense probably benign 0.41
IGL03169:Lamb1 APN 12 31323646 missense probably damaging 1.00
Crush UTSW 12 31287424 missense probably damaging 1.00
Deflationary UTSW 12 31321075 missense probably null 0.63
E0374:Lamb1 UTSW 12 31287930 missense probably damaging 1.00
P0043:Lamb1 UTSW 12 31278621 missense probably damaging 1.00
R0031:Lamb1 UTSW 12 31301156 missense probably benign 0.04
R0047:Lamb1 UTSW 12 31278601 missense possibly damaging 0.51
R0047:Lamb1 UTSW 12 31278601 missense possibly damaging 0.51
R0285:Lamb1 UTSW 12 31326645 nonsense probably null
R0456:Lamb1 UTSW 12 31304730 missense probably damaging 1.00
R0477:Lamb1 UTSW 12 31326269 missense possibly damaging 0.47
R0480:Lamb1 UTSW 12 31282721 missense possibly damaging 0.79
R0544:Lamb1 UTSW 12 31282695 missense probably damaging 1.00
R0565:Lamb1 UTSW 12 31298915 missense probably benign 0.02
R1500:Lamb1 UTSW 12 31298949 missense possibly damaging 0.82
R1624:Lamb1 UTSW 12 31278652 critical splice donor site probably null
R1772:Lamb1 UTSW 12 31278525 missense probably damaging 1.00
R1836:Lamb1 UTSW 12 31301094 missense probably benign 0.00
R1853:Lamb1 UTSW 12 31318272 missense probably damaging 1.00
R1854:Lamb1 UTSW 12 31318272 missense probably damaging 1.00
R1903:Lamb1 UTSW 12 31329210 missense probably damaging 1.00
R2091:Lamb1 UTSW 12 31287429 missense probably damaging 0.98
R2186:Lamb1 UTSW 12 31318467 nonsense probably null
R2268:Lamb1 UTSW 12 31327645 missense probably damaging 1.00
R2567:Lamb1 UTSW 12 31269055 critical splice acceptor site probably null
R2698:Lamb1 UTSW 12 31298883 missense probably benign 0.10
R3121:Lamb1 UTSW 12 31287529 missense probably damaging 1.00
R3405:Lamb1 UTSW 12 31287529 missense probably damaging 1.00
R3406:Lamb1 UTSW 12 31287529 missense probably damaging 1.00
R3608:Lamb1 UTSW 12 31287910 missense probably damaging 1.00
R3725:Lamb1 UTSW 12 31321075 missense probably null 0.63
R3726:Lamb1 UTSW 12 31321075 missense probably null 0.63
R3949:Lamb1 UTSW 12 31282649 missense probably damaging 1.00
R4308:Lamb1 UTSW 12 31329255 missense probably damaging 1.00
R4600:Lamb1 UTSW 12 31323529 missense probably benign 0.00
R4604:Lamb1 UTSW 12 31278776 missense probably damaging 1.00
R4701:Lamb1 UTSW 12 31266848 nonsense probably null
R4710:Lamb1 UTSW 12 31282583 missense probably benign 0.02
R4767:Lamb1 UTSW 12 31308011 missense probably damaging 1.00
R4809:Lamb1 UTSW 12 31278526 missense probably damaging 1.00
R4828:Lamb1 UTSW 12 31298930 missense probably benign
R4842:Lamb1 UTSW 12 31287433 missense probably damaging 1.00
R4864:Lamb1 UTSW 12 31321006 missense probably benign 0.01
R4909:Lamb1 UTSW 12 31288281 missense probably damaging 1.00
R4989:Lamb1 UTSW 12 31326678 missense probably damaging 1.00
R5444:Lamb1 UTSW 12 31298909 missense possibly damaging 0.47
R5736:Lamb1 UTSW 12 31302665 nonsense probably null
R5825:Lamb1 UTSW 12 31318614 missense probably benign
R5840:Lamb1 UTSW 12 31266756 missense probably damaging 1.00
R5867:Lamb1 UTSW 12 31298955 missense possibly damaging 0.82
R5887:Lamb1 UTSW 12 31266864 nonsense probably null
R5984:Lamb1 UTSW 12 31327774 missense possibly damaging 0.76
R6313:Lamb1 UTSW 12 31269147 missense probably damaging 1.00
R6359:Lamb1 UTSW 12 31282716 missense probably damaging 0.97
R6505:Lamb1 UTSW 12 31323462 missense possibly damaging 0.63
R7127:Lamb1 UTSW 12 31324315 missense probably damaging 1.00
R7202:Lamb1 UTSW 12 31324315 missense probably damaging 1.00
R7271:Lamb1 UTSW 12 31287424 missense probably damaging 1.00
R7290:Lamb1 UTSW 12 31265596 missense probably benign 0.04
R7486:Lamb1 UTSW 12 31287442 missense probably benign 0.00
R7496:Lamb1 UTSW 12 31300021 missense probably benign 0.31
R7591:Lamb1 UTSW 12 31326648 missense probably damaging 1.00
R7722:Lamb1 UTSW 12 31323571 missense probably damaging 0.99
R7985:Lamb1 UTSW 12 31300215 missense possibly damaging 0.93
R8058:Lamb1 UTSW 12 31303047 missense probably benign 0.16
R8353:Lamb1 UTSW 12 31306999 missense probably damaging 1.00
R8506:Lamb1 UTSW 12 31329361 missense probably damaging 1.00
R8846:Lamb1 UTSW 12 31329389 missense possibly damaging 0.75
R8888:Lamb1 UTSW 12 31302954 missense possibly damaging 0.95
R8895:Lamb1 UTSW 12 31302954 missense possibly damaging 0.95
R9312:Lamb1 UTSW 12 31318353 missense probably damaging 1.00
R9340:Lamb1 UTSW 12 31324224 missense probably benign
R9340:Lamb1 UTSW 12 31324225 missense probably benign
R9371:Lamb1 UTSW 12 31298864 missense probably damaging 0.98
R9417:Lamb1 UTSW 12 31287984 missense probably damaging 1.00
R9562:Lamb1 UTSW 12 31272493 missense probably damaging 1.00
R9626:Lamb1 UTSW 12 31304670 missense probably benign
R9641:Lamb1 UTSW 12 31287458 missense probably damaging 0.97
X0054:Lamb1 UTSW 12 31287434 missense probably damaging 1.00
X0064:Lamb1 UTSW 12 31303042 missense probably benign 0.35
Z1176:Lamb1 UTSW 12 31327702 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AAAGGCTGTCTTGAGCAGG -3'
(R):5'- AACAGAGGGCCTTCCATAGC -3'

Sequencing Primer
(F):5'- TTCCGTGAGCCTTACCGG -3'
(R):5'- TAGCCAGTGACTCAGTCTCTAAG -3'
Posted On 2016-11-21