Mutagenetix > Incidental Mutation

Incidental Mutation 'R5766:Ralgapa1'

446295

Institutional Source

Beutler Lab

Gene Symbol

Ralgapa1

Ensembl Gene

ENSMUSG00000021027

Gene Name

Ral GTPase activating protein, alpha subunit 1

Synonyms

Garnl1, 4930400K19Rik, 2310003F20Rik, Tulip1

MMRRC Submission

044424-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.855) question?

Stock #

R5766 (G1)

Quality Score

122

Status

Not validated

Chromosome

Chromosomal Location

55602896-55821167 bp(-) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

A to T at 55820766 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1 (M1K)

Ref Sequence

ENSEMBL: ENSMUSP00000154749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]

AlphaFold

Q6GYP7

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000061934

Predicted Effect

probably null
Transcript: ENSMUST00000085385
AA Change: M1K

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: M1K

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2003	7.4e-66	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000110687
AA Change: M1K

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: M1K

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2001	1.9e-48	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175208

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217762

Predicted Effect

probably null
Transcript: ENSMUST00000219432
AA Change: M1K

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219529

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219542

Predicted Effect

probably null
Transcript: ENSMUST00000220367
AA Change: M1K

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

probably null
Transcript: ENSMUST00000226244
AA Change: M1K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	G	A	7: 28,137,329	W224*	probably null	Het
Aadacl3	A	G	4: 144,455,869	V343A	probably damaging	Het
AI429214	TCCCTGATGAAC	TC	8: 36,994,229		probably null	Het
Arid2	A	G	15: 96,372,205	T1400A	probably benign	Het
Arrdc1	G	A	2: 24,926,405	T184I	probably damaging	Het
Aspm	T	C	1: 139,479,002	F1876L	probably damaging	Het
Calhm1	C	T	19: 47,143,703	V158I	probably benign	Het
Caly	T	C	7: 140,070,397	K211E	probably benign	Het
Cenpe	T	C	3: 135,248,413	L1677P	probably damaging	Het
Cttnbp2	A	G	6: 18,381,033	V1388A	possibly damaging	Het
Dgkd	C	T	1: 87,880,449	R80*	probably null	Het
Dnah3	A	T	7: 119,978,222	I2072N	probably damaging	Het
Dnah8	A	G	17: 30,690,261	I1020M	probably benign	Het
Drc3	T	C	11: 60,393,821	V484A	probably benign	Het
Efcab8	A	G	2: 153,780,992	D27G	possibly damaging	Het
Fat4	G	A	3: 38,889,468	G837R	probably damaging	Het
Fgb	A	T	3: 83,046,176	C96S	probably damaging	Het
Flt4	G	C	11: 49,626,686	W278C	possibly damaging	Het
Fmnl2	T	C	2: 53,101,454	V327A	probably damaging	Het
Fras1	A	T	5: 96,731,689	Y2455F	possibly damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm13872	T	A	2: 102,737,909	I88N	probably damaging	Het
Hoxa6	A	G	6: 52,208,414	S71P	probably benign	Het
Hunk	T	A	16: 90,453,739	C148S	probably damaging	Het
Ighv1-18	A	C	12: 114,682,907	S26A	probably damaging	Het
Impg2	T	G	16: 56,259,820	D553E	possibly damaging	Het
Ints1	A	G	5: 139,772,145	I266T	probably benign	Het
Kpna3	G	T	14: 61,403,014	T33K	probably benign	Het
Lamb1	A	G	12: 31,299,931	D622G	probably damaging	Het
Lamp3	T	C	16: 19,701,317	T39A	probably damaging	Het
Mnt	C	T	11: 74,843,078		probably benign	Het
Msh4	A	G	3: 153,867,840	S726P	probably damaging	Het
Olfr539	T	A	7: 140,667,353	V22E	probably benign	Het
Pah	A	C	10: 87,567,347	K195Q	probably damaging	Het
Pdc	T	A	1: 150,333,500	*245K	probably null	Het
Pdzd8	A	T	19: 59,300,540	H809Q	possibly damaging	Het
Plekhd1	A	T	12: 80,722,366	I467L	probably benign	Het
Ppp2ca	A	G	11: 52,113,187	D57G	probably damaging	Het
Rfx2	T	A	17: 56,803,587	D133V	probably benign	Het
Scfd2	A	T	5: 74,462,651	L407Q	probably damaging	Het
Scp2d1	T	A	2: 144,824,037	S99T	possibly damaging	Het
Sec63	A	T	10: 42,801,681	N261I	probably damaging	Het
Slc8a1	T	C	17: 81,648,961	Y216C	probably damaging	Het
Son	T	A	16: 91,664,987		probably benign	Het
Syce1	T	C	7: 140,777,981	E285G	probably damaging	Het
Taar7a	G	T	10: 23,993,362	S40R	probably benign	Het
Ube3a	A	T	7: 59,276,059	D216V	possibly damaging	Het
Vgll2	A	G	10: 52,027,563	D174G	probably damaging	Het
Vmn2r17	A	T	5: 109,427,273	T149S	possibly damaging	Het
Zbtb39	G	T	10: 127,742,688	C377F	probably damaging	Het
Zfp820	T	A	17: 21,820,002	N115I	probably damaging	Het
Zfp948	T	C	17: 21,584,816	S23P	probably benign	Het

Other mutations in Ralgapa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ralgapa1	APN	12	55722773	missense	probably damaging	0.98
IGL00494:Ralgapa1	APN	12	55747185	missense	probably damaging	1.00
IGL00731:Ralgapa1	APN	12	55702452	missense	possibly damaging	0.94
IGL00851:Ralgapa1	APN	12	55709575	missense	possibly damaging	0.93
IGL01133:Ralgapa1	APN	12	55642348	missense	probably damaging	1.00
IGL01133:Ralgapa1	APN	12	55642359	missense	probably damaging	0.99
IGL01354:Ralgapa1	APN	12	55777316	missense	possibly damaging	0.68
IGL01514:Ralgapa1	APN	12	55719657	missense	probably damaging	0.97
IGL02033:Ralgapa1	APN	12	55642477	missense	possibly damaging	0.69
IGL02064:Ralgapa1	APN	12	55708077	missense	probably damaging	1.00
IGL02556:Ralgapa1	APN	12	55642449	missense	possibly damaging	0.80
IGL02605:Ralgapa1	APN	12	55712665	missense	possibly damaging	0.90
IGL02657:Ralgapa1	APN	12	55673507	missense	probably damaging	1.00
IGL02676:Ralgapa1	APN	12	55676417	missense	probably damaging	1.00
IGL02894:Ralgapa1	APN	12	55717069	missense	possibly damaging	0.79
IGL02944:Ralgapa1	APN	12	55757951	missense	probably benign	0.01
Anhydrous	UTSW	12	55795778	critical splice acceptor site	probably null
Aqueous	UTSW	12	55698854	missense	probably damaging	1.00
bantam	UTSW	12	55722773	critical splice donor site	probably null
Deliquescent	UTSW	12	55782900	splice site	probably benign
wickedwarlock	UTSW	12	55777292	missense	probably null	0.99
F5770:Ralgapa1	UTSW	12	55795653	splice site	probably benign
IGL03046:Ralgapa1	UTSW	12	55695157	missense	probably damaging	1.00
R0011:Ralgapa1	UTSW	12	55786263	missense	probably damaging	0.99
R0096:Ralgapa1	UTSW	12	55739505	missense	probably damaging	1.00
R0277:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0323:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0333:Ralgapa1	UTSW	12	55782900	splice site	probably benign
R0361:Ralgapa1	UTSW	12	55676569	missense	possibly damaging	0.93
R0385:Ralgapa1	UTSW	12	55677038	missense	probably damaging	1.00
R0386:Ralgapa1	UTSW	12	55708067	missense	probably benign	0.03
R0498:Ralgapa1	UTSW	12	55689791	missense	possibly damaging	0.66
R0552:Ralgapa1	UTSW	12	55676765	missense	probably benign	0.27
R0564:Ralgapa1	UTSW	12	55782885	missense	possibly damaging	0.84
R0611:Ralgapa1	UTSW	12	55795698	missense	probably damaging	0.99
R0730:Ralgapa1	UTSW	12	55665663	missense	probably damaging	1.00
R0741:Ralgapa1	UTSW	12	55676581	missense	probably damaging	0.99
R0815:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0815:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R0863:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0863:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R1068:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1256:Ralgapa1	UTSW	12	55762661	missense	possibly damaging	0.94
R1343:Ralgapa1	UTSW	12	55707978	missense	probably damaging	1.00
R1378:Ralgapa1	UTSW	12	55676926	missense	probably damaging	1.00
R1474:Ralgapa1	UTSW	12	55741480	missense	probably benign	0.09
R1494:Ralgapa1	UTSW	12	55684524	missense	probably damaging	0.99
R1593:Ralgapa1	UTSW	12	55770703	missense	probably damaging	1.00
R1607:Ralgapa1	UTSW	12	55741536	missense	probably damaging	1.00
R1681:Ralgapa1	UTSW	12	55762603	missense	probably benign	0.35
R1689:Ralgapa1	UTSW	12	55676767	missense	possibly damaging	0.79
R1714:Ralgapa1	UTSW	12	55642389	missense	probably damaging	1.00
R1832:Ralgapa1	UTSW	12	55757967	missense	probably benign	0.03
R1870:Ralgapa1	UTSW	12	55677032	missense	possibly damaging	0.66
R2040:Ralgapa1	UTSW	12	55786322	missense	probably damaging	1.00
R2043:Ralgapa1	UTSW	12	55677026	missense	probably damaging	0.99
R2046:Ralgapa1	UTSW	12	55695160	missense	probably damaging	1.00
R2109:Ralgapa1	UTSW	12	55776188	missense	possibly damaging	0.90
R2114:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2115:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2202:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2203:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2233:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2235:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2341:Ralgapa1	UTSW	12	55677124	missense	possibly damaging	0.66
R2507:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2508:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2972:Ralgapa1	UTSW	12	55820755	missense	possibly damaging	0.61
R3160:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3162:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3401:Ralgapa1	UTSW	12	55659137	missense	possibly damaging	0.66
R3416:Ralgapa1	UTSW	12	55770613	splice site	probably benign
R3499:Ralgapa1	UTSW	12	55695143	splice site	probably benign
R3799:Ralgapa1	UTSW	12	55659130	missense	probably damaging	1.00
R3948:Ralgapa1	UTSW	12	55698767	missense	probably damaging	1.00
R4039:Ralgapa1	UTSW	12	55795701	missense	probably damaging	0.99
R4120:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4165:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4166:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4212:Ralgapa1	UTSW	12	55739330	critical splice donor site	probably null
R4232:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4233:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4234:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4235:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4399:Ralgapa1	UTSW	12	55795778	critical splice acceptor site	probably null
R4698:Ralgapa1	UTSW	12	55677276	splice site	probably null
R4715:Ralgapa1	UTSW	12	55693458	missense	probably damaging	1.00
R4755:Ralgapa1	UTSW	12	55712748	missense	probably damaging	1.00
R4810:Ralgapa1	UTSW	12	55794993	critical splice donor site	probably null
R4827:Ralgapa1	UTSW	12	55676437	missense	probably damaging	1.00
R4849:Ralgapa1	UTSW	12	55698803	missense	probably damaging	0.99
R4934:Ralgapa1	UTSW	12	55762574	missense	possibly damaging	0.94
R5006:Ralgapa1	UTSW	12	55718114	missense	probably benign	0.02
R5114:Ralgapa1	UTSW	12	55612723	missense	possibly damaging	0.84
R5140:Ralgapa1	UTSW	12	55776152	missense	probably damaging	1.00
R5140:Ralgapa1	UTSW	12	55665674	missense	probably damaging	1.00
R5168:Ralgapa1	UTSW	12	55758032	missense	probably benign	0.05
R5407:Ralgapa1	UTSW	12	55676797	missense	possibly damaging	0.93
R5441:Ralgapa1	UTSW	12	55719623	missense	probably damaging	1.00
R5473:Ralgapa1	UTSW	12	55676710	missense	probably benign	0.41
R5624:Ralgapa1	UTSW	12	55612738	missense	probably damaging	1.00
R5826:Ralgapa1	UTSW	12	55677113	missense	probably damaging	1.00
R5950:Ralgapa1	UTSW	12	55738265	missense	possibly damaging	0.58
R5980:Ralgapa1	UTSW	12	55770616	splice site	probably null
R6019:Ralgapa1	UTSW	12	55684042	missense	possibly damaging	0.92
R6065:Ralgapa1	UTSW	12	55757924	critical splice donor site	probably null
R6326:Ralgapa1	UTSW	12	55747146	missense	probably damaging	1.00
R6355:Ralgapa1	UTSW	12	55698854	missense	probably damaging	1.00
R6408:Ralgapa1	UTSW	12	55683910	nonsense	probably null
R6448:Ralgapa1	UTSW	12	55719661	missense	probably benign	0.14
R6453:Ralgapa1	UTSW	12	55738319	missense	probably damaging	1.00
R6590:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6690:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6738:Ralgapa1	UTSW	12	55762727	missense	probably damaging	1.00
R6836:Ralgapa1	UTSW	12	55604273	splice site	probably null
R6936:Ralgapa1	UTSW	12	55786212	missense	probably damaging	0.99
R6945:Ralgapa1	UTSW	12	55776191	missense	possibly damaging	0.64
R7028:Ralgapa1	UTSW	12	55758059	missense	probably damaging	1.00
R7075:Ralgapa1	UTSW	12	55820723	missense	possibly damaging	0.66
R7076:Ralgapa1	UTSW	12	55721576	missense	possibly damaging	0.82
R7098:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R7231:Ralgapa1	UTSW	12	55604191	missense	probably damaging	1.00
R7254:Ralgapa1	UTSW	12	55695193	missense	probably damaging	1.00
R7326:Ralgapa1	UTSW	12	55709004	missense	probably damaging	1.00
R7485:Ralgapa1	UTSW	12	55712672	missense	probably damaging	1.00
R7580:Ralgapa1	UTSW	12	55718228	missense	probably benign	0.00
R7677:Ralgapa1	UTSW	12	55659143	missense	probably damaging	0.96
R7702:Ralgapa1	UTSW	12	55709555	missense	probably damaging	1.00
R7702:Ralgapa1	UTSW	12	55709556	missense	probably damaging	1.00
R7707:Ralgapa1	UTSW	12	55777292	missense	probably null	0.99
R7723:Ralgapa1	UTSW	12	55741513	missense	probably benign
R7763:Ralgapa1	UTSW	12	55757955	missense	probably benign	0.28
R7791:Ralgapa1	UTSW	12	55741519	missense	probably damaging	0.97
R7812:Ralgapa1	UTSW	12	55719628	missense	possibly damaging	0.67
R7868:Ralgapa1	UTSW	12	55612638	missense	probably benign	0.00
R7895:Ralgapa1	UTSW	12	55747149	missense	probably benign	0.44
R7896:Ralgapa1	UTSW	12	55697878	missense	probably benign	0.01
R8004:Ralgapa1	UTSW	12	55702457	missense	probably damaging	0.99
R8094:Ralgapa1	UTSW	12	55782846	missense	probably damaging	0.99
R8213:Ralgapa1	UTSW	12	55722914	missense	probably damaging	0.99
R8307:Ralgapa1	UTSW	12	55741523	missense	probably damaging	0.99
R8423:Ralgapa1	UTSW	12	55659062	missense	probably damaging	0.99
R8462:Ralgapa1	UTSW	12	55676518	missense	possibly damaging	0.90
R8469:Ralgapa1	UTSW	12	55739413	missense	probably damaging	1.00
R8675:Ralgapa1	UTSW	12	55738217	missense	possibly damaging	0.93
R8802:Ralgapa1	UTSW	12	55738316	missense	probably damaging	0.99
R8937:Ralgapa1	UTSW	12	55702560	missense	probably damaging	0.96
R8953:Ralgapa1	UTSW	12	55820761	missense	probably damaging	0.99
R8974:Ralgapa1	UTSW	12	55677006	missense	probably benign
R9011:Ralgapa1	UTSW	12	55605529	intron	probably benign
R9089:Ralgapa1	UTSW	12	55676566	missense	probably damaging	0.97
R9124:Ralgapa1	UTSW	12	55735096	missense	probably damaging	1.00
R9254:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
R9320:Ralgapa1	UTSW	12	55709058	missense	possibly damaging	0.59
R9379:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
R9446:Ralgapa1	UTSW	12	55708023	missense	probably damaging	0.97
R9684:Ralgapa1	UTSW	12	55612700	missense	possibly damaging	0.63
Z1176:Ralgapa1	UTSW	12	55709080	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACCAACTGCCAAGCTGTCC -3'
(R):5'- GAGACGCTTCAACCTTAAGGG -3'

Sequencing Primer
(F):5'- AACTGCCAAGCTGTCCCCTTC -3'
(R):5'- TTCAACCTTAAGGGGGCCTCAG -3'

Posted On

2016-11-21