Incidental Mutation 'R5766:Kpna3'
ID446298
Institutional Source Beutler Lab
Gene Symbol Kpna3
Ensembl Gene ENSMUSG00000021929
Gene Namekaryopherin (importin) alpha 3
SynonymsIPOA4
MMRRC Submission 044424-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.622) question?
Stock #R5766 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location61365211-61439874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 61403014 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 33 (T33K)
Ref Sequence ENSEMBL: ENSMUSP00000022496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022496]
Predicted Effect probably benign
Transcript: ENSMUST00000022496
AA Change: T33K

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022496
Gene: ENSMUSG00000021929
AA Change: T33K

DomainStartEndE-ValueType
Pfam:IBB 7 93 1e-25 PFAM
ARM 103 144 9.52e-11 SMART
ARM 146 186 2.15e-9 SMART
ARM 188 229 8.59e0 SMART
ARM 232 271 1.78e-1 SMART
ARM 273 313 4.31e-9 SMART
ARM 315 355 5.91e-7 SMART
ARM 357 397 5.22e-8 SMART
ARM 400 440 1.51e-4 SMART
Pfam:Arm_3 447 499 5.4e-25 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC), which consists of 60-100 proteins. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion while larger molecules are transported by an active process. The protein encoded by this gene belongs to the importin alpha family, and is involved in nuclear protein import. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,137,329 W224* probably null Het
Aadacl3 A G 4: 144,455,869 V343A probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Arid2 A G 15: 96,372,205 T1400A probably benign Het
Arrdc1 G A 2: 24,926,405 T184I probably damaging Het
Aspm T C 1: 139,479,002 F1876L probably damaging Het
Calhm1 C T 19: 47,143,703 V158I probably benign Het
Caly T C 7: 140,070,397 K211E probably benign Het
Cenpe T C 3: 135,248,413 L1677P probably damaging Het
Cttnbp2 A G 6: 18,381,033 V1388A possibly damaging Het
Dgkd C T 1: 87,880,449 R80* probably null Het
Dnah3 A T 7: 119,978,222 I2072N probably damaging Het
Dnah8 A G 17: 30,690,261 I1020M probably benign Het
Drc3 T C 11: 60,393,821 V484A probably benign Het
Efcab8 A G 2: 153,780,992 D27G possibly damaging Het
Fat4 G A 3: 38,889,468 G837R probably damaging Het
Fgb A T 3: 83,046,176 C96S probably damaging Het
Flt4 G C 11: 49,626,686 W278C possibly damaging Het
Fmnl2 T C 2: 53,101,454 V327A probably damaging Het
Fras1 A T 5: 96,731,689 Y2455F possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm13872 T A 2: 102,737,909 I88N probably damaging Het
Hoxa6 A G 6: 52,208,414 S71P probably benign Het
Hunk T A 16: 90,453,739 C148S probably damaging Het
Ighv1-18 A C 12: 114,682,907 S26A probably damaging Het
Impg2 T G 16: 56,259,820 D553E possibly damaging Het
Ints1 A G 5: 139,772,145 I266T probably benign Het
Lamb1 A G 12: 31,299,931 D622G probably damaging Het
Lamp3 T C 16: 19,701,317 T39A probably damaging Het
Mnt C T 11: 74,843,078 probably benign Het
Msh4 A G 3: 153,867,840 S726P probably damaging Het
Olfr539 T A 7: 140,667,353 V22E probably benign Het
Pah A C 10: 87,567,347 K195Q probably damaging Het
Pdc T A 1: 150,333,500 *245K probably null Het
Pdzd8 A T 19: 59,300,540 H809Q possibly damaging Het
Plekhd1 A T 12: 80,722,366 I467L probably benign Het
Ppp2ca A G 11: 52,113,187 D57G probably damaging Het
Ralgapa1 A T 12: 55,820,766 M1K probably null Het
Rfx2 T A 17: 56,803,587 D133V probably benign Het
Scfd2 A T 5: 74,462,651 L407Q probably damaging Het
Scp2d1 T A 2: 144,824,037 S99T possibly damaging Het
Sec63 A T 10: 42,801,681 N261I probably damaging Het
Slc8a1 T C 17: 81,648,961 Y216C probably damaging Het
Son T A 16: 91,664,987 probably benign Het
Syce1 T C 7: 140,777,981 E285G probably damaging Het
Taar7a G T 10: 23,993,362 S40R probably benign Het
Ube3a A T 7: 59,276,059 D216V possibly damaging Het
Vgll2 A G 10: 52,027,563 D174G probably damaging Het
Vmn2r17 A T 5: 109,427,273 T149S possibly damaging Het
Zbtb39 G T 10: 127,742,688 C377F probably damaging Het
Zfp820 T A 17: 21,820,002 N115I probably damaging Het
Zfp948 T C 17: 21,584,816 S23P probably benign Het
Other mutations in Kpna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Kpna3 APN 14 61374288 missense possibly damaging 0.94
IGL00321:Kpna3 APN 14 61391853 splice site probably benign
IGL01013:Kpna3 APN 14 61370517 missense probably damaging 1.00
IGL01833:Kpna3 APN 14 61370445 missense possibly damaging 0.92
IGL02661:Kpna3 APN 14 61372949 splice site probably benign
IGL03070:Kpna3 APN 14 61370782 splice site probably benign
R1428:Kpna3 UTSW 14 61383220 splice site probably benign
R1719:Kpna3 UTSW 14 61387477 missense probably damaging 1.00
R1728:Kpna3 UTSW 14 61367701 missense probably benign 0.00
R1760:Kpna3 UTSW 14 61370541 missense probably benign 0.03
R1784:Kpna3 UTSW 14 61367701 missense probably benign 0.00
R2107:Kpna3 UTSW 14 61370484 missense possibly damaging 0.52
R4184:Kpna3 UTSW 14 61368175 missense probably damaging 0.96
R4952:Kpna3 UTSW 14 61370389 missense probably damaging 1.00
R5081:Kpna3 UTSW 14 61391245 missense probably damaging 0.97
R5887:Kpna3 UTSW 14 61403012 missense probably benign 0.04
R5927:Kpna3 UTSW 14 61384647 missense probably damaging 0.96
R7116:Kpna3 UTSW 14 61368186 missense probably benign 0.32
R7615:Kpna3 UTSW 14 61372962 missense possibly damaging 0.81
R7674:Kpna3 UTSW 14 61367637 missense probably benign
R7799:Kpna3 UTSW 14 61384733 missense probably damaging 1.00
R8115:Kpna3 UTSW 14 61370918 missense probably damaging 1.00
R8239:Kpna3 UTSW 14 61387470 missense probably damaging 1.00
R8896:Kpna3 UTSW 14 61391845 missense not run
Predicted Primers PCR Primer
(F):5'- GCTGATTCTCATAAACTTTCACTGA -3'
(R):5'- ATACAACACTGTCAGCTTTCTAGCTAA -3'

Sequencing Primer
(F):5'- CAGCTAGTGACTTTAGATGGCCC -3'
(R):5'- GTACACAGTCATATATTCAGGCAGGC -3'
Posted On2016-11-21