Mutagenetix > Incidental Mutation

Incidental Mutation 'R5766:Arid2'

446299

Institutional Source

Beutler Lab

Gene Symbol

Arid2

Ensembl Gene

ENSMUSG00000033237

Gene Name

AT rich interactive domain 2 (ARID, RFX-like)

Synonyms

4432409D24Rik, 1700124K17Rik, zipzap/p200

MMRRC Submission

044424-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5766 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

96287518-96404992 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96372205 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1400 (T1400A)

Ref Sequence

ENSEMBL: ENSMUSP00000093969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096250]

AlphaFold

E9Q7E2

Predicted Effect

probably benign
Transcript: ENSMUST00000096250
AA Change: T1400A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000093969
Gene: ENSMUSG00000033237
AA Change: T1400A

Domain	Start	End	E-Value	Type
ARID	10	101	9.67e-36	SMART
BRIGHT	14	106	3.67e-34	SMART
Pfam:RFX_DNA_binding	521	603	1.7e-26	PFAM
internal_repeat_1	767	843	3.29e-6	PROSPERO
low complexity region	902	942	N/A	INTRINSIC
low complexity region	965	986	N/A	INTRINSIC
low complexity region	1012	1054	N/A	INTRINSIC
low complexity region	1118	1131	N/A	INTRINSIC
internal_repeat_1	1132	1215	3.29e-6	PROSPERO
low complexity region	1453	1468	N/A	INTRINSIC
low complexity region	1590	1614	N/A	INTRINSIC
ZnF_C2H2	1626	1651	4.34e0	SMART
ZnF_C2H2	1659	1684	4.74e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176739

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interactive domain (ARID)-containing family of DNA-binding proteins. Members of the ARID family have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation and chromatin structure modification. This protein functions as a subunit of the polybromo- and BRG1-associated factor or PBAF (SWI/SNF-B) chromatin remodeling complex which facilitates ligand-dependent transcriptional activation by nuclear receptors. Mutations in this gene are associated with hepatocellular carcinomas. A pseudogene of this gene is found on chromosome1. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E12.5 and E14.5, congenital heart defects, impaired coronary artery development, subcutaneous edema and hemorrhage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	G	A	7: 28,137,329	W224*	probably null	Het
Aadacl3	A	G	4: 144,455,869	V343A	probably damaging	Het
AI429214	TCCCTGATGAAC	TC	8: 36,994,229		probably null	Het
Arrdc1	G	A	2: 24,926,405	T184I	probably damaging	Het
Aspm	T	C	1: 139,479,002	F1876L	probably damaging	Het
Calhm1	C	T	19: 47,143,703	V158I	probably benign	Het
Caly	T	C	7: 140,070,397	K211E	probably benign	Het
Cenpe	T	C	3: 135,248,413	L1677P	probably damaging	Het
Cttnbp2	A	G	6: 18,381,033	V1388A	possibly damaging	Het
Dgkd	C	T	1: 87,880,449	R80*	probably null	Het
Dnah3	A	T	7: 119,978,222	I2072N	probably damaging	Het
Dnah8	A	G	17: 30,690,261	I1020M	probably benign	Het
Drc3	T	C	11: 60,393,821	V484A	probably benign	Het
Efcab8	A	G	2: 153,780,992	D27G	possibly damaging	Het
Fat4	G	A	3: 38,889,468	G837R	probably damaging	Het
Fgb	A	T	3: 83,046,176	C96S	probably damaging	Het
Flt4	G	C	11: 49,626,686	W278C	possibly damaging	Het
Fmnl2	T	C	2: 53,101,454	V327A	probably damaging	Het
Fras1	A	T	5: 96,731,689	Y2455F	possibly damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm13872	T	A	2: 102,737,909	I88N	probably damaging	Het
Hoxa6	A	G	6: 52,208,414	S71P	probably benign	Het
Hunk	T	A	16: 90,453,739	C148S	probably damaging	Het
Ighv1-18	A	C	12: 114,682,907	S26A	probably damaging	Het
Impg2	T	G	16: 56,259,820	D553E	possibly damaging	Het
Ints1	A	G	5: 139,772,145	I266T	probably benign	Het
Kpna3	G	T	14: 61,403,014	T33K	probably benign	Het
Lamb1	A	G	12: 31,299,931	D622G	probably damaging	Het
Lamp3	T	C	16: 19,701,317	T39A	probably damaging	Het
Mnt	C	T	11: 74,843,078		probably benign	Het
Msh4	A	G	3: 153,867,840	S726P	probably damaging	Het
Olfr539	T	A	7: 140,667,353	V22E	probably benign	Het
Pah	A	C	10: 87,567,347	K195Q	probably damaging	Het
Pdc	T	A	1: 150,333,500	*245K	probably null	Het
Pdzd8	A	T	19: 59,300,540	H809Q	possibly damaging	Het
Plekhd1	A	T	12: 80,722,366	I467L	probably benign	Het
Ppp2ca	A	G	11: 52,113,187	D57G	probably damaging	Het
Ralgapa1	A	T	12: 55,820,766	M1K	probably null	Het
Rfx2	T	A	17: 56,803,587	D133V	probably benign	Het
Scfd2	A	T	5: 74,462,651	L407Q	probably damaging	Het
Scp2d1	T	A	2: 144,824,037	S99T	possibly damaging	Het
Sec63	A	T	10: 42,801,681	N261I	probably damaging	Het
Slc8a1	T	C	17: 81,648,961	Y216C	probably damaging	Het
Son	T	A	16: 91,664,987		probably benign	Het
Syce1	T	C	7: 140,777,981	E285G	probably damaging	Het
Taar7a	G	T	10: 23,993,362	S40R	probably benign	Het
Ube3a	A	T	7: 59,276,059	D216V	possibly damaging	Het
Vgll2	A	G	10: 52,027,563	D174G	probably damaging	Het
Vmn2r17	A	T	5: 109,427,273	T149S	possibly damaging	Het
Zbtb39	G	T	10: 127,742,688	C377F	probably damaging	Het
Zfp820	T	A	17: 21,820,002	N115I	probably damaging	Het
Zfp948	T	C	17: 21,584,816	S23P	probably benign	Het

Other mutations in Arid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Arid2	APN	15	96372302	missense	probably benign
IGL00321:Arid2	APN	15	96289089	missense	probably damaging	0.97
IGL00434:Arid2	APN	15	96371300	missense	probably damaging	0.99
IGL00576:Arid2	APN	15	96356758	missense	probably damaging	0.99
IGL00766:Arid2	APN	15	96370405	missense	probably benign	0.09
IGL01563:Arid2	APN	15	96372397	missense	probably damaging	0.99
IGL01697:Arid2	APN	15	96361572	critical splice acceptor site	probably null
IGL01845:Arid2	APN	15	96356797	missense	probably damaging	1.00
IGL02159:Arid2	APN	15	96358912	splice site	probably benign
IGL02341:Arid2	APN	15	96372185	missense	probably benign
IGL02416:Arid2	APN	15	96350055	missense	possibly damaging	0.63
IGL02578:Arid2	APN	15	96372235	missense	probably benign	0.00
IGL02598:Arid2	APN	15	96371536	missense	probably damaging	1.00
IGL02644:Arid2	APN	15	96368708	missense	probably damaging	1.00
IGL02653:Arid2	APN	15	96287702	missense	probably damaging	0.99
IGL03115:Arid2	APN	15	96370273	missense	probably damaging	1.00
IGL03137:Arid2	APN	15	96371318	missense	probably benign	0.44
IGL03220:Arid2	APN	15	96361772	missense	probably damaging	0.99
IGL03249:Arid2	APN	15	96401965	missense	probably damaging	1.00
IGL03256:Arid2	APN	15	96370762	missense	probably benign	0.18
IGL03386:Arid2	APN	15	96361574	missense	probably damaging	1.00
H8562:Arid2	UTSW	15	96369546	missense	possibly damaging	0.77
I2288:Arid2	UTSW	15	96369511	missense	possibly damaging	0.95
R0254:Arid2	UTSW	15	96370571	missense	probably damaging	0.97
R0284:Arid2	UTSW	15	96378967	splice site	probably benign
R0347:Arid2	UTSW	15	96370952	missense	probably benign	0.01
R0366:Arid2	UTSW	15	96361720	splice site	probably benign
R0400:Arid2	UTSW	15	96356925	unclassified	probably benign
R0650:Arid2	UTSW	15	96402049	missense	possibly damaging	0.47
R0651:Arid2	UTSW	15	96402049	missense	possibly damaging	0.47
R1034:Arid2	UTSW	15	96369505	missense	probably benign	0.01
R1615:Arid2	UTSW	15	96371654	missense	possibly damaging	0.59
R1696:Arid2	UTSW	15	96370183	missense	probably benign	0.01
R2024:Arid2	UTSW	15	96361799	missense	probably damaging	1.00
R2046:Arid2	UTSW	15	96369387	missense	probably damaging	1.00
R2069:Arid2	UTSW	15	96362590	missense	probably damaging	1.00
R2149:Arid2	UTSW	15	96370835	missense	probably damaging	1.00
R2300:Arid2	UTSW	15	96402006	missense	probably damaging	1.00
R2336:Arid2	UTSW	15	96362549	missense	probably damaging	1.00
R2359:Arid2	UTSW	15	96361878	missense	probably damaging	1.00
R2368:Arid2	UTSW	15	96350012	missense	possibly damaging	0.83
R2829:Arid2	UTSW	15	96369454	missense	possibly damaging	0.95
R3013:Arid2	UTSW	15	96361936	missense	probably damaging	1.00
R3109:Arid2	UTSW	15	96356746	missense	probably damaging	1.00
R3765:Arid2	UTSW	15	96370714	missense	probably benign	0.01
R3785:Arid2	UTSW	15	96372558	missense	possibly damaging	0.83
R3811:Arid2	UTSW	15	96289086	missense	probably benign	0.01
R3812:Arid2	UTSW	15	96289086	missense	probably benign	0.01
R3813:Arid2	UTSW	15	96369950	missense	probably benign	0.26
R3843:Arid2	UTSW	15	96351840	missense	possibly damaging	0.86
R3978:Arid2	UTSW	15	96363622	missense	probably damaging	1.00
R4279:Arid2	UTSW	15	96371756	missense	probably damaging	1.00
R4569:Arid2	UTSW	15	96392462	missense	probably damaging	1.00
R4597:Arid2	UTSW	15	96370856	missense	probably damaging	1.00
R5020:Arid2	UTSW	15	96371988	missense	probably damaging	0.96
R5154:Arid2	UTSW	15	96401985	missense	probably damaging	1.00
R5303:Arid2	UTSW	15	96392468	missense	probably damaging	1.00
R5620:Arid2	UTSW	15	96372506	missense	probably benign	0.20
R6005:Arid2	UTSW	15	96370972	missense	probably benign
R6169:Arid2	UTSW	15	96368677	missense	probably benign	0.36
R6216:Arid2	UTSW	15	96356909	missense	probably benign	0.18
R6392:Arid2	UTSW	15	96361602	missense	probably damaging	0.99
R6430:Arid2	UTSW	15	96363694	missense	probably benign
R6454:Arid2	UTSW	15	96372413	missense	probably benign	0.20
R6672:Arid2	UTSW	15	96362345	missense	probably benign	0.30
R6776:Arid2	UTSW	15	96370949	missense	probably benign	0.00
R6985:Arid2	UTSW	15	96370148	missense	probably benign	0.06
R7132:Arid2	UTSW	15	96350013	missense	possibly damaging	0.67
R7133:Arid2	UTSW	15	96378875	missense	probably damaging	0.99
R7453:Arid2	UTSW	15	96370724	missense	probably benign
R7562:Arid2	UTSW	15	96401968	missense	probably damaging	1.00
R7594:Arid2	UTSW	15	96390994	missense	probably damaging	1.00
R7692:Arid2	UTSW	15	96356697	nonsense	probably null
R7792:Arid2	UTSW	15	96369375	missense	probably benign	0.05
R8036:Arid2	UTSW	15	96368744	missense	probably damaging	1.00
R8094:Arid2	UTSW	15	96368711	missense	possibly damaging	0.86
R8327:Arid2	UTSW	15	96362604	missense	probably damaging	1.00
R9065:Arid2	UTSW	15	96371491	missense	probably benign	0.44
R9143:Arid2	UTSW	15	96361834	missense	probably damaging	0.99
R9320:Arid2	UTSW	15	96371186	missense	probably damaging	1.00
R9346:Arid2	UTSW	15	96287911	missense	probably benign	0.01
R9519:Arid2	UTSW	15	96289067	missense	possibly damaging	0.46
R9651:Arid2	UTSW	15	96358941	missense	probably benign	0.44
X0024:Arid2	UTSW	15	96372490	missense	probably benign	0.00
X0066:Arid2	UTSW	15	96356804	missense	probably damaging	1.00
Z1177:Arid2	UTSW	15	96390986	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATGCAGGATGTCAAAGGTGATC -3'
(R):5'- TGCTATGACTTGATGCCCCTG -3'

Sequencing Primer
(F):5'- AAGCCCTCGTCAATGGAA -3'
(R):5'- ACAACTACACTTGGGCGTTG -3'

Posted On

2016-11-21