Incidental Mutation 'V8831:Cpsf2'
ID44630
Institutional Source Beutler Lab
Gene Symbol Cpsf2
Ensembl Gene ENSMUSG00000041781
Gene Namecleavage and polyadenylation specific factor 2
Synonyms100kDa, 2610024B04Rik, Cpsf
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #V8831 () of strain 710
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location101975988-102006424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102003141 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 757 (R757C)
Ref Sequence ENSEMBL: ENSMUSP00000047797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047357]
Predicted Effect probably damaging
Transcript: ENSMUST00000047357
AA Change: R757C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047797
Gene: ENSMUSG00000041781
AA Change: R757C

DomainStartEndE-ValueType
Lactamase_B 17 223 5.22e-1 SMART
Beta-Casp 243 368 1.8e-21 SMART
coiled coil region 380 418 N/A INTRINSIC
Pfam:RMMBL 527 569 1.2e-14 PFAM
Pfam:CPSF100_C 608 779 5.7e-46 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsa1 A G 12: 87,269,923 N107S probably damaging Het
Arhgap23 A G 11: 97,456,545 I690V probably benign Het
Bard1 G A 1: 71,088,217 P78S probably damaging Het
Ccar1 G A 10: 62,747,406 T976I unknown Het
Cdc7 T A 5: 106,968,910 N50K probably benign Het
Cep85 C T 4: 134,156,069 E170K possibly damaging Het
Csmd3 A T 15: 48,457,696 D239E probably damaging Het
Dnah7b T G 1: 46,373,298 Y4022* probably null Het
Elmo3 A G 8: 105,307,061 N179S probably benign Het
H2-T24 T A 17: 36,017,324 Q89L probably damaging Het
Hist1h2bj G C 13: 22,043,281 probably benign Het
Irak4 T C 15: 94,561,484 I327T probably damaging Het
Itpr2 A T 6: 146,385,882 L157Q probably damaging Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lrrc72 G T 12: 36,208,657 T67K possibly damaging Het
Map2 T G 1: 66,415,845 I1298S probably damaging Het
Mroh2a T TN 1: 88,256,167 probably null Het
Ndst1 G A 18: 60,702,927 A428V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1369-ps1 T C 13: 21,116,003 Y104H possibly damaging Het
Olfr177 G T 16: 58,873,075 T25K probably benign Het
Olfr481 C T 7: 108,081,535 A247V probably benign Het
Plxna1 A G 6: 89,357,137 V170A probably damaging Het
Rfx6 G A 10: 51,718,208 probably null Het
Shprh G A 10: 11,186,862 D1238N probably damaging Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc9c1 A T 16: 45,577,899 I676F possibly damaging Het
Smoc1 A G 12: 81,168,255 D305G probably damaging Het
Spdef C T 17: 27,718,077 R184H probably damaging Het
Stxbp4 C T 11: 90,480,671 A535T probably benign Het
Tcp11l1 C G 2: 104,685,484 V345L probably benign Het
Ticam1 TC T 17: 56,269,969 probably null Het
Ttc28 A T 5: 111,100,712 Y177F probably benign Het
Ugt2b34 A T 5: 86,906,674 Y83N probably benign Het
Vmn2r30 G A 7: 7,334,149 R163C probably benign Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Other mutations in Cpsf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Cpsf2 APN 12 101983466 missense probably damaging 1.00
IGL01114:Cpsf2 APN 12 101989839 missense possibly damaging 0.93
IGL01121:Cpsf2 APN 12 101988706 missense probably damaging 1.00
IGL01377:Cpsf2 APN 12 101987381 splice site probably null
IGL01465:Cpsf2 APN 12 101997333 missense probably damaging 1.00
IGL02861:Cpsf2 APN 12 101999566 missense probably benign 0.00
R0469:Cpsf2 UTSW 12 101988786 missense probably damaging 1.00
R0504:Cpsf2 UTSW 12 101990003 missense probably damaging 1.00
R0510:Cpsf2 UTSW 12 101988786 missense probably damaging 1.00
R0626:Cpsf2 UTSW 12 101985231 missense probably benign 0.09
R0697:Cpsf2 UTSW 12 101983184 missense probably benign 0.34
R0837:Cpsf2 UTSW 12 101997242 splice site probably benign
R1475:Cpsf2 UTSW 12 101985236 missense probably damaging 1.00
R1709:Cpsf2 UTSW 12 101999542 missense probably damaging 1.00
R1974:Cpsf2 UTSW 12 101990047 missense probably benign 0.33
R1996:Cpsf2 UTSW 12 101998608 missense probably benign 0.18
R2063:Cpsf2 UTSW 12 101983463 missense probably damaging 1.00
R2164:Cpsf2 UTSW 12 101985335 missense probably damaging 1.00
R2228:Cpsf2 UTSW 12 101989829 missense probably benign 0.00
R3082:Cpsf2 UTSW 12 101988810 missense probably damaging 0.99
R3732:Cpsf2 UTSW 12 101987308 missense probably damaging 0.99
R3732:Cpsf2 UTSW 12 101987308 missense probably damaging 0.99
R3733:Cpsf2 UTSW 12 101987308 missense probably damaging 0.99
R4627:Cpsf2 UTSW 12 101989895 missense probably benign 0.18
R4665:Cpsf2 UTSW 12 101983207 missense probably damaging 1.00
R4666:Cpsf2 UTSW 12 101983207 missense probably damaging 1.00
R4765:Cpsf2 UTSW 12 101997440 missense probably damaging 1.00
R4777:Cpsf2 UTSW 12 101996832 missense probably damaging 0.99
R4847:Cpsf2 UTSW 12 101997302 missense probably benign 0.18
R4923:Cpsf2 UTSW 12 101981984 missense probably benign
R4975:Cpsf2 UTSW 12 101983493 missense probably damaging 1.00
R5239:Cpsf2 UTSW 12 101987273 nonsense probably null
R5440:Cpsf2 UTSW 12 101996879 missense probably benign
R5601:Cpsf2 UTSW 12 101985355 splice site probably null
R5603:Cpsf2 UTSW 12 101998631 missense probably benign 0.02
R5841:Cpsf2 UTSW 12 101985238 missense probably damaging 0.99
R6153:Cpsf2 UTSW 12 101999360 splice site probably null
R6663:Cpsf2 UTSW 12 101999593 missense probably damaging 1.00
R7451:Cpsf2 UTSW 12 102000792 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CTGGCTGTAAAGGCTGATAGCAGTG -3'
(R):5'- CATGCTCACGTTTTCTGGCAGATTC -3'

Sequencing Primer
(F):5'- GCAGTGATTCAAGTGAATGGTACATC -3'
(R):5'- CTGGCAGATTCTTTTTGTATGTTAC -3'
Posted On2013-06-11