Incidental Mutation 'R5767:Sgo2a'
ID446312
Institutional Source Beutler Lab
Gene Symbol Sgo2a
Ensembl Gene ENSMUSG00000026039
Gene Nameshugoshin 2A
SynonymsSgol2a, Sgol2, 1110007N04Rik, D1Ertd8e, 5730576N04Rik, Tripin
MMRRC Submission 043367-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5767 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location57995971-58025899 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 58019660 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1133 (E1133*)
Ref Sequence ENSEMBL: ENSMUSP00000027202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027202] [ENSMUST00000163061]
Predicted Effect probably null
Transcript: ENSMUST00000027202
AA Change: E1133*
SMART Domains Protein: ENSMUSP00000027202
Gene: ENSMUSG00000026039
AA Change: E1133*

DomainStartEndE-ValueType
coiled coil region 54 109 N/A INTRINSIC
low complexity region 182 198 N/A INTRINSIC
low complexity region 371 381 N/A INTRINSIC
low complexity region 396 431 N/A INTRINSIC
low complexity region 583 597 N/A INTRINSIC
low complexity region 718 729 N/A INTRINSIC
low complexity region 1068 1078 N/A INTRINSIC
low complexity region 1112 1125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163061
SMART Domains Protein: ENSMUSP00000124053
Gene: ENSMUSG00000054770

DomainStartEndE-ValueType
BTB 23 123 1.01e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190746
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with abnormalities in meiosis but not in mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 A T 10: 89,726,755 D87E probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Ano3 A T 2: 110,661,271 Y887N probably damaging Het
Arid4a A G 12: 71,060,093 D313G probably damaging Het
Armc2 A G 10: 42,011,927 V20A probably benign Het
C2 T A 17: 34,876,456 N171I possibly damaging Het
Cdh1 C A 8: 106,668,555 N865K probably damaging Het
Cep89 T A 7: 35,417,645 V224E probably damaging Het
Dennd2d C T 3: 106,487,815 probably benign Het
Diaph1 T A 18: 37,853,355 K1157N probably damaging Het
Dsg4 T A 18: 20,462,492 L584* probably null Het
Exoc4 G A 6: 33,918,432 A795T probably benign Het
Fbln5 A T 12: 101,765,209 I242N probably damaging Het
Gls2 A G 10: 128,205,221 H394R probably damaging Het
Gm27013 C T 6: 130,675,958 C847Y possibly damaging Het
Ifna5 C A 4: 88,835,799 T92K possibly damaging Het
Ireb2 A G 9: 54,900,516 M674V probably benign Het
Itga2 C T 13: 114,839,570 V1089M possibly damaging Het
Kctd16 A T 18: 40,258,869 Y170F probably benign Het
Kif15 A G 9: 123,013,974 N45D possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mink1 A G 11: 70,606,075 K420E possibly damaging Het
Ms4a14 G T 19: 11,302,027 Q1056K probably benign Het
Olfr1053 T A 2: 86,314,398 E296V probably damaging Het
Olfr175-ps1 T C 16: 58,823,953 Y252C probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Ovch2 T C 7: 107,781,978 E571G probably benign Het
Pmel T C 10: 128,714,381 V95A probably damaging Het
Ptger2 G T 14: 44,989,142 G60C probably benign Het
Ranbp2 T G 10: 58,476,825 S1122R probably benign Het
Rasal2 T C 1: 157,176,162 D309G probably damaging Het
Rcc2 T A 4: 140,715,919 C303S probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpini1 C T 3: 75,613,081 probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smarcc1 G A 9: 110,132,183 probably benign Het
Tbcd A G 11: 121,592,692 E749G probably benign Het
Tmc3 G A 7: 83,599,982 A260T probably benign Het
Tnfrsf21 A G 17: 43,037,659 Y54C probably damaging Het
Uhrf1bp1l A G 10: 89,787,199 D312G possibly damaging Het
Urb1 T A 16: 90,776,163 M994L probably benign Het
Usp14 A T 18: 10,009,935 probably benign Het
Vps13a T C 19: 16,664,564 Y2233C probably damaging Het
Wdr66 G A 5: 123,298,521 V1038I probably benign Het
Wnt2 G T 6: 17,990,028 A290E probably damaging Het
Zc3h8 A T 2: 128,930,892 C225* probably null Het
Other mutations in Sgo2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Sgo2a APN 1 58016594 missense probably damaging 1.00
IGL00534:Sgo2a APN 1 58016344 missense probably damaging 1.00
IGL00902:Sgo2a APN 1 58016099 missense probably benign 0.00
IGL01571:Sgo2a APN 1 58017974 missense probably damaging 0.99
IGL02268:Sgo2a APN 1 58017722 missense probably benign 0.10
IGL02756:Sgo2a APN 1 58016350 missense probably damaging 1.00
IGL02887:Sgo2a APN 1 58016352 missense probably damaging 0.99
IGL02991:Sgo2a APN 1 58015355 intron probably benign
harpo UTSW 1 58019660 nonsense probably null
mashugana UTSW 1 58016567 missense probably damaging 1.00
meshugas UTSW 1 58002933 nonsense probably null
R0036:Sgo2a UTSW 1 58015628 missense probably benign 0.14
R0036:Sgo2a UTSW 1 58015628 missense probably benign 0.14
R0095:Sgo2a UTSW 1 58015555 missense probably benign 0.11
R0325:Sgo2a UTSW 1 58016697 missense probably benign
R0464:Sgo2a UTSW 1 58000094 missense probably damaging 0.98
R0699:Sgo2a UTSW 1 57998149 nonsense probably null
R1251:Sgo2a UTSW 1 57999962 critical splice acceptor site probably null
R1355:Sgo2a UTSW 1 58017965 missense possibly damaging 0.91
R1457:Sgo2a UTSW 1 58015806 missense probably benign 0.00
R2244:Sgo2a UTSW 1 58017054 missense probably benign 0.00
R3896:Sgo2a UTSW 1 58013646 missense probably damaging 0.99
R4919:Sgo2a UTSW 1 57998134 missense probably damaging 0.99
R5030:Sgo2a UTSW 1 58017759 nonsense probably null
R5123:Sgo2a UTSW 1 58016567 missense probably damaging 1.00
R5317:Sgo2a UTSW 1 58015524 missense probably benign
R5844:Sgo2a UTSW 1 58016397 missense probably damaging 0.99
R6018:Sgo2a UTSW 1 58016959 missense probably benign 0.01
R6039:Sgo2a UTSW 1 58016616 missense possibly damaging 0.78
R6039:Sgo2a UTSW 1 58016616 missense possibly damaging 0.78
R6450:Sgo2a UTSW 1 58002933 nonsense probably null
R6998:Sgo2a UTSW 1 58016640 missense probably damaging 0.99
R7073:Sgo2a UTSW 1 58017785 missense possibly damaging 0.73
R7508:Sgo2a UTSW 1 58017795 missense probably benign 0.11
R7722:Sgo2a UTSW 1 58016537 missense probably benign 0.45
X0065:Sgo2a UTSW 1 58016358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGTTTACTTTACATCTTAGCTCC -3'
(R):5'- CCAGAGCTTATGTGGAACAGA -3'

Sequencing Primer
(F):5'- AGCTCCTTTTTCTCTCAAAATCGAG -3'
(R):5'- GAGCTTATGTGGAACAGATTCATATG -3'
Posted On2016-11-21