Incidental Mutation 'R5767:Rasal2'
ID446315
Institutional Source Beutler Lab
Gene Symbol Rasal2
Ensembl Gene ENSMUSG00000070565
Gene NameRAS protein activator like 2
SynonymsA330066M24Rik
MMRRC Submission 043367-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5767 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location157135182-157412595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 157176162 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 309 (D309G)
Ref Sequence ENSEMBL: ENSMUSP00000114964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078308] [ENSMUST00000129880] [ENSMUST00000132699] [ENSMUST00000134543] [ENSMUST00000143358]
Predicted Effect probably damaging
Transcript: ENSMUST00000078308
AA Change: D327G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077423
Gene: ENSMUSG00000070565
AA Change: D327G

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
PH 58 307 3.97e-8 SMART
C2 317 413 6.01e-10 SMART
RasGAP 423 767 4.56e-157 SMART
low complexity region 780 791 N/A INTRINSIC
low complexity region 1063 1075 N/A INTRINSIC
low complexity region 1084 1092 N/A INTRINSIC
coiled coil region 1117 1236 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128538
Predicted Effect possibly damaging
Transcript: ENSMUST00000129880
AA Change: D263G

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118367
Gene: ENSMUSG00000070565
AA Change: D263G

DomainStartEndE-ValueType
PH 128 243 8.46e-3 SMART
Pfam:C2 252 323 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132699
AA Change: D309G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114964
Gene: ENSMUSG00000070565
AA Change: D309G

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
PH 40 289 1.7e-10 SMART
C2 299 395 4e-12 SMART
RasGAP 405 742 4.2e-153 SMART
low complexity region 755 766 N/A INTRINSIC
low complexity region 1038 1050 N/A INTRINSIC
low complexity region 1059 1067 N/A INTRINSIC
coiled coil region 1092 1211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134543
SMART Domains Protein: ENSMUSP00000119623
Gene: ENSMUSG00000070565

DomainStartEndE-ValueType
PH 45 160 8.46e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143358
SMART Domains Protein: ENSMUSP00000116974
Gene: ENSMUSG00000070565

DomainStartEndE-ValueType
Blast:PH 1 147 2e-83 BLAST
Meta Mutation Damage Score 0.1352 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains the GAP-related domain (GRD), a characteristic domain of GTPase-activating proteins (GAPs). GAPs function as activators of Ras superfamily of small GTPases. The protein encoded by this gene is able to complement the defective RasGAP function in a yeast system. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced survival and decreased tumor latency. In other tumorigenic models, this allele promotes increase metastatic potential. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 A T 10: 89,726,755 D87E probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Ano3 A T 2: 110,661,271 Y887N probably damaging Het
Arid4a A G 12: 71,060,093 D313G probably damaging Het
Armc2 A G 10: 42,011,927 V20A probably benign Het
C2 T A 17: 34,876,456 N171I possibly damaging Het
Cdh1 C A 8: 106,668,555 N865K probably damaging Het
Cep89 T A 7: 35,417,645 V224E probably damaging Het
Dennd2d C T 3: 106,487,815 probably benign Het
Diaph1 T A 18: 37,853,355 K1157N probably damaging Het
Dsg4 T A 18: 20,462,492 L584* probably null Het
Exoc4 G A 6: 33,918,432 A795T probably benign Het
Fbln5 A T 12: 101,765,209 I242N probably damaging Het
Gls2 A G 10: 128,205,221 H394R probably damaging Het
Gm27013 C T 6: 130,675,958 C847Y possibly damaging Het
Ifna5 C A 4: 88,835,799 T92K possibly damaging Het
Ireb2 A G 9: 54,900,516 M674V probably benign Het
Itga2 C T 13: 114,839,570 V1089M possibly damaging Het
Kctd16 A T 18: 40,258,869 Y170F probably benign Het
Kif15 A G 9: 123,013,974 N45D possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mink1 A G 11: 70,606,075 K420E possibly damaging Het
Ms4a14 G T 19: 11,302,027 Q1056K probably benign Het
Olfr1053 T A 2: 86,314,398 E296V probably damaging Het
Olfr175-ps1 T C 16: 58,823,953 Y252C probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Ovch2 T C 7: 107,781,978 E571G probably benign Het
Pmel T C 10: 128,714,381 V95A probably damaging Het
Ptger2 G T 14: 44,989,142 G60C probably benign Het
Ranbp2 T G 10: 58,476,825 S1122R probably benign Het
Rcc2 T A 4: 140,715,919 C303S probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpini1 C T 3: 75,613,081 probably benign Het
Sgo2a G T 1: 58,019,660 E1133* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smarcc1 G A 9: 110,132,183 probably benign Het
Tbcd A G 11: 121,592,692 E749G probably benign Het
Tmc3 G A 7: 83,599,982 A260T probably benign Het
Tnfrsf21 A G 17: 43,037,659 Y54C probably damaging Het
Uhrf1bp1l A G 10: 89,787,199 D312G possibly damaging Het
Urb1 T A 16: 90,776,163 M994L probably benign Het
Usp14 A T 18: 10,009,935 probably benign Het
Vps13a T C 19: 16,664,564 Y2233C probably damaging Het
Wdr66 G A 5: 123,298,521 V1038I probably benign Het
Wnt2 G T 6: 17,990,028 A290E probably damaging Het
Zc3h8 A T 2: 128,930,892 C225* probably null Het
Other mutations in Rasal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Rasal2 APN 1 157147817 missense probably benign
IGL00484:Rasal2 APN 1 157174175 unclassified probably null
IGL00731:Rasal2 APN 1 157157764 missense probably benign 0.01
IGL00900:Rasal2 APN 1 157411929 missense possibly damaging 0.73
IGL01346:Rasal2 APN 1 157161216 missense probably benign 0.19
IGL01635:Rasal2 APN 1 157163824 missense probably damaging 1.00
IGL01759:Rasal2 APN 1 157175932 missense probably benign 0.42
IGL01939:Rasal2 APN 1 157175910 missense probably damaging 1.00
IGL01954:Rasal2 APN 1 157177699 missense possibly damaging 0.83
IGL01954:Rasal2 APN 1 157176116 missense probably damaging 0.99
IGL02005:Rasal2 APN 1 157156998 nonsense probably null
IGL02056:Rasal2 APN 1 157299261 missense probably damaging 0.99
IGL02444:Rasal2 APN 1 157299195 missense probably benign 0.20
IGL02496:Rasal2 APN 1 157149879 missense possibly damaging 0.69
IGL02832:Rasal2 APN 1 157157207 missense probably damaging 1.00
IGL03351:Rasal2 APN 1 157192741 splice site probably benign
R0456:Rasal2 UTSW 1 157149843 missense probably damaging 1.00
R0537:Rasal2 UTSW 1 157147792 missense possibly damaging 0.46
R0681:Rasal2 UTSW 1 157157180 missense possibly damaging 0.70
R0682:Rasal2 UTSW 1 157179209 missense probably damaging 1.00
R0683:Rasal2 UTSW 1 157179209 missense probably damaging 1.00
R0787:Rasal2 UTSW 1 157158696 missense probably damaging 1.00
R0789:Rasal2 UTSW 1 157157321 missense probably damaging 1.00
R1109:Rasal2 UTSW 1 157177638 unclassified probably benign
R1175:Rasal2 UTSW 1 157147648 missense probably damaging 1.00
R1332:Rasal2 UTSW 1 157175821 missense probably benign 0.00
R1396:Rasal2 UTSW 1 157164666 missense probably damaging 1.00
R1535:Rasal2 UTSW 1 157230059 missense probably benign 0.28
R1542:Rasal2 UTSW 1 157175851 missense possibly damaging 0.84
R1703:Rasal2 UTSW 1 157157600 missense probably damaging 1.00
R1735:Rasal2 UTSW 1 157174160 missense probably damaging 1.00
R1762:Rasal2 UTSW 1 157299144 missense possibly damaging 0.52
R2570:Rasal2 UTSW 1 157161300 missense possibly damaging 0.85
R3148:Rasal2 UTSW 1 157243764 intron probably benign
R3157:Rasal2 UTSW 1 157158655 splice site probably benign
R4277:Rasal2 UTSW 1 157157126 missense possibly damaging 0.46
R4459:Rasal2 UTSW 1 157175832 missense possibly damaging 0.46
R4460:Rasal2 UTSW 1 157175832 missense possibly damaging 0.46
R4563:Rasal2 UTSW 1 157175991 missense probably damaging 1.00
R4672:Rasal2 UTSW 1 157243661 missense probably benign 0.10
R4894:Rasal2 UTSW 1 157192804 missense probably damaging 0.97
R5147:Rasal2 UTSW 1 157175694 missense probably damaging 1.00
R5387:Rasal2 UTSW 1 157157765 missense possibly damaging 0.81
R5421:Rasal2 UTSW 1 157299141 missense probably benign 0.37
R5459:Rasal2 UTSW 1 157157661 missense probably damaging 0.99
R5651:Rasal2 UTSW 1 157157381 missense probably damaging 1.00
R5778:Rasal2 UTSW 1 157161290 missense probably damaging 1.00
R6298:Rasal2 UTSW 1 157411862 missense possibly damaging 0.85
R6332:Rasal2 UTSW 1 157299187 missense probably damaging 1.00
R6571:Rasal2 UTSW 1 157161179 missense possibly damaging 0.72
R7258:Rasal2 UTSW 1 157157700 missense probably damaging 0.96
R7545:Rasal2 UTSW 1 157192769 missense possibly damaging 0.93
R7558:Rasal2 UTSW 1 157175836 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGTGGGGATATTGACTAGC -3'
(R):5'- GGTCCTAAACGATAAGATGGTGATTC -3'

Sequencing Primer
(F):5'- CTAGCCCTACATAATTATTCTTGTCC -3'
(R):5'- TGGTGATTCTTATTTATTGACTGCTC -3'
Posted On2016-11-21