Incidental Mutation 'R5767:Olfr1053'
ID446316
Institutional Source Beutler Lab
Gene Symbol Olfr1053
Ensembl Gene ENSMUSG00000075192
Gene Nameolfactory receptor 1053
SynonymsGA_x6K02T2Q125-47793414-47792471, Olfr1053-ps1, MOR187-4
MMRRC Submission 043367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5767 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86314343-86315284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86314398 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 296 (E296V)
Ref Sequence ENSEMBL: ENSMUSP00000097481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099897]
Predicted Effect probably damaging
Transcript: ENSMUST00000099897
AA Change: E296V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097481
Gene: ENSMUSG00000075192
AA Change: E296V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1e-45 PFAM
Pfam:7tm_1 41 290 1.2e-17 PFAM
Meta Mutation Damage Score 0.6024 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 A T 10: 89,726,755 D87E probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Ano3 A T 2: 110,661,271 Y887N probably damaging Het
Arid4a A G 12: 71,060,093 D313G probably damaging Het
Armc2 A G 10: 42,011,927 V20A probably benign Het
C2 T A 17: 34,876,456 N171I possibly damaging Het
Cdh1 C A 8: 106,668,555 N865K probably damaging Het
Cep89 T A 7: 35,417,645 V224E probably damaging Het
Dennd2d C T 3: 106,487,815 probably benign Het
Diaph1 T A 18: 37,853,355 K1157N probably damaging Het
Dsg4 T A 18: 20,462,492 L584* probably null Het
Exoc4 G A 6: 33,918,432 A795T probably benign Het
Fbln5 A T 12: 101,765,209 I242N probably damaging Het
Gls2 A G 10: 128,205,221 H394R probably damaging Het
Gm27013 C T 6: 130,675,958 C847Y possibly damaging Het
Ifna5 C A 4: 88,835,799 T92K possibly damaging Het
Ireb2 A G 9: 54,900,516 M674V probably benign Het
Itga2 C T 13: 114,839,570 V1089M possibly damaging Het
Kctd16 A T 18: 40,258,869 Y170F probably benign Het
Kif15 A G 9: 123,013,974 N45D possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mink1 A G 11: 70,606,075 K420E possibly damaging Het
Ms4a14 G T 19: 11,302,027 Q1056K probably benign Het
Olfr175-ps1 T C 16: 58,823,953 Y252C probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Ovch2 T C 7: 107,781,978 E571G probably benign Het
Pmel T C 10: 128,714,381 V95A probably damaging Het
Ptger2 G T 14: 44,989,142 G60C probably benign Het
Ranbp2 T G 10: 58,476,825 S1122R probably benign Het
Rasal2 T C 1: 157,176,162 D309G probably damaging Het
Rcc2 T A 4: 140,715,919 C303S probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpini1 C T 3: 75,613,081 probably benign Het
Sgo2a G T 1: 58,019,660 E1133* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smarcc1 G A 9: 110,132,183 probably benign Het
Tbcd A G 11: 121,592,692 E749G probably benign Het
Tmc3 G A 7: 83,599,982 A260T probably benign Het
Tnfrsf21 A G 17: 43,037,659 Y54C probably damaging Het
Uhrf1bp1l A G 10: 89,787,199 D312G possibly damaging Het
Urb1 T A 16: 90,776,163 M994L probably benign Het
Usp14 A T 18: 10,009,935 probably benign Het
Vps13a T C 19: 16,664,564 Y2233C probably damaging Het
Wdr66 G A 5: 123,298,521 V1038I probably benign Het
Wnt2 G T 6: 17,990,028 A290E probably damaging Het
Zc3h8 A T 2: 128,930,892 C225* probably null Het
Other mutations in Olfr1053
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Olfr1053 APN 2 86314944 missense probably damaging 1.00
IGL02063:Olfr1053 APN 2 86314793 missense possibly damaging 0.50
IGL02503:Olfr1053 APN 2 86314639 missense possibly damaging 0.71
IGL03342:Olfr1053 APN 2 86315235 missense possibly damaging 0.85
PIT4520001:Olfr1053 UTSW 2 86314798 missense possibly damaging 0.78
R0562:Olfr1053 UTSW 2 86314525 missense probably benign 0.00
R1026:Olfr1053 UTSW 2 86315214 missense possibly damaging 0.80
R1134:Olfr1053 UTSW 2 86315181 missense probably damaging 1.00
R1200:Olfr1053 UTSW 2 86315133 missense probably damaging 0.99
R1566:Olfr1053 UTSW 2 86314785 missense probably benign 0.01
R1588:Olfr1053 UTSW 2 86314530 missense probably damaging 1.00
R1747:Olfr1053 UTSW 2 86314867 missense probably benign 0.00
R1951:Olfr1053 UTSW 2 86315160 missense probably damaging 1.00
R1975:Olfr1053 UTSW 2 86315154 missense probably damaging 0.99
R2291:Olfr1053 UTSW 2 86315180 nonsense probably null
R2425:Olfr1053 UTSW 2 86314395 missense probably damaging 0.98
R5092:Olfr1053 UTSW 2 86314362 missense probably benign 0.00
R5651:Olfr1053 UTSW 2 86314440 missense probably benign 0.23
R5733:Olfr1053 UTSW 2 86315214 missense probably damaging 0.98
R6307:Olfr1053 UTSW 2 86315124 missense probably benign
R6720:Olfr1053 UTSW 2 86315065 missense probably damaging 0.99
R7067:Olfr1053 UTSW 2 86314567 missense probably damaging 1.00
R7289:Olfr1053 UTSW 2 86315025 missense probably benign 0.00
R7604:Olfr1053 UTSW 2 86314900 missense probably damaging 1.00
R7773:Olfr1053 UTSW 2 86314690 missense probably benign 0.01
R8345:Olfr1053 UTSW 2 86315107 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGGTACAGTGCTAGATATAACG -3'
(R):5'- ACATGTGGGTCTCATTTGACAG -3'

Sequencing Primer
(F):5'- AGTGCTAGATATAACGAAAATTCTGG -3'
(R):5'- CTCATTTGACAGTGGTTGTGG -3'
Posted On2016-11-21