Incidental Mutation 'R5767:Zc3h8'
ID446317
Institutional Source Beutler Lab
Gene Symbol Zc3h8
Ensembl Gene ENSMUSG00000027387
Gene Namezinc finger CCCH type containing 8
SynonymsE130108N08Rik, Fliz1
MMRRC Submission 043367-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R5767 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location128926268-128944077 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 128930892 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 225 (C225*)
Ref Sequence ENSEMBL: ENSMUSP00000028866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028866]
Predicted Effect probably null
Transcript: ENSMUST00000028866
AA Change: C225*
SMART Domains Protein: ENSMUSP00000028866
Gene: ENSMUSG00000027387
AA Change: C225*

DomainStartEndE-ValueType
low complexity region 33 48 N/A INTRINSIC
low complexity region 67 79 N/A INTRINSIC
low complexity region 134 159 N/A INTRINSIC
ZnF_C3H1 206 231 1.92e-2 SMART
ZnF_C3H1 235 260 6.99e-5 SMART
ZnF_C3H1 262 284 9.88e0 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 A T 10: 89,726,755 D87E probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Ano3 A T 2: 110,661,271 Y887N probably damaging Het
Arid4a A G 12: 71,060,093 D313G probably damaging Het
Armc2 A G 10: 42,011,927 V20A probably benign Het
C2 T A 17: 34,876,456 N171I possibly damaging Het
Cdh1 C A 8: 106,668,555 N865K probably damaging Het
Cep89 T A 7: 35,417,645 V224E probably damaging Het
Dennd2d C T 3: 106,487,815 probably benign Het
Diaph1 T A 18: 37,853,355 K1157N probably damaging Het
Dsg4 T A 18: 20,462,492 L584* probably null Het
Exoc4 G A 6: 33,918,432 A795T probably benign Het
Fbln5 A T 12: 101,765,209 I242N probably damaging Het
Gls2 A G 10: 128,205,221 H394R probably damaging Het
Gm27013 C T 6: 130,675,958 C847Y possibly damaging Het
Ifna5 C A 4: 88,835,799 T92K possibly damaging Het
Ireb2 A G 9: 54,900,516 M674V probably benign Het
Itga2 C T 13: 114,839,570 V1089M possibly damaging Het
Kctd16 A T 18: 40,258,869 Y170F probably benign Het
Kif15 A G 9: 123,013,974 N45D possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mink1 A G 11: 70,606,075 K420E possibly damaging Het
Ms4a14 G T 19: 11,302,027 Q1056K probably benign Het
Olfr1053 T A 2: 86,314,398 E296V probably damaging Het
Olfr175-ps1 T C 16: 58,823,953 Y252C probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Ovch2 T C 7: 107,781,978 E571G probably benign Het
Pmel T C 10: 128,714,381 V95A probably damaging Het
Ptger2 G T 14: 44,989,142 G60C probably benign Het
Ranbp2 T G 10: 58,476,825 S1122R probably benign Het
Rasal2 T C 1: 157,176,162 D309G probably damaging Het
Rcc2 T A 4: 140,715,919 C303S probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpini1 C T 3: 75,613,081 probably benign Het
Sgo2a G T 1: 58,019,660 E1133* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smarcc1 G A 9: 110,132,183 probably benign Het
Tbcd A G 11: 121,592,692 E749G probably benign Het
Tmc3 G A 7: 83,599,982 A260T probably benign Het
Tnfrsf21 A G 17: 43,037,659 Y54C probably damaging Het
Uhrf1bp1l A G 10: 89,787,199 D312G possibly damaging Het
Urb1 T A 16: 90,776,163 M994L probably benign Het
Usp14 A T 18: 10,009,935 probably benign Het
Vps13a T C 19: 16,664,564 Y2233C probably damaging Het
Wdr66 G A 5: 123,298,521 V1038I probably benign Het
Wnt2 G T 6: 17,990,028 A290E probably damaging Het
Other mutations in Zc3h8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02530:Zc3h8 APN 2 128943926 utr 5 prime probably benign
R1251:Zc3h8 UTSW 2 128935369 missense probably benign 0.02
R1657:Zc3h8 UTSW 2 128929957 critical splice acceptor site probably benign
R5304:Zc3h8 UTSW 2 128928915 missense probably benign
R5840:Zc3h8 UTSW 2 128929904 missense probably benign 0.00
R6174:Zc3h8 UTSW 2 128943855 nonsense probably null
R7090:Zc3h8 UTSW 2 128935321 missense possibly damaging 0.52
R7468:Zc3h8 UTSW 2 128933295 missense probably benign 0.00
R7660:Zc3h8 UTSW 2 128930822 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGAACAGACCTGTACGTTAAGAG -3'
(R):5'- AAGTTTTAGAAGTGCAGCAGGC -3'

Sequencing Primer
(F):5'- GGGCTTAAACAGAACACCTTTG -3'
(R):5'- CTGAGTCATGTGCTCAGATGC -3'
Posted On2016-11-21