Incidental Mutation 'V8831:Hist1h2bj'
ID44632
Institutional Source Beutler Lab
Gene Symbol Hist1h2bj
Ensembl Gene ENSMUSG00000069300
Gene Namehistone cluster 1, H2bj
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #V8831 () of strain 710
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location22043214-22043676 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to C at 22043281 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091741] [ENSMUST00000102977] [ENSMUST00000110452]
Predicted Effect probably benign
Transcript: ENSMUST00000091741
SMART Domains Protein: ENSMUSP00000089335
Gene: ENSMUSG00000069301

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102977
SMART Domains Protein: ENSMUSP00000100042
Gene: ENSMUSG00000060639

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Predicted Effect unknown
Transcript: ENSMUST00000110452
AA Change: A18P
SMART Domains Protein: ENSMUSP00000106082
Gene: ENSMUSG00000069300
AA Change: A18P

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198508
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsa1 A G 12: 87,269,923 N107S probably damaging Het
Arhgap23 A G 11: 97,456,545 I690V probably benign Het
Bard1 G A 1: 71,088,217 P78S probably damaging Het
Ccar1 G A 10: 62,747,406 T976I unknown Het
Cdc7 T A 5: 106,968,910 N50K probably benign Het
Cep85 C T 4: 134,156,069 E170K possibly damaging Het
Cpsf2 C T 12: 102,003,141 R757C probably damaging Het
Csmd3 A T 15: 48,457,696 D239E probably damaging Het
Dnah7b T G 1: 46,373,298 Y4022* probably null Het
Elmo3 A G 8: 105,307,061 N179S probably benign Het
H2-T24 T A 17: 36,017,324 Q89L probably damaging Het
Irak4 T C 15: 94,561,484 I327T probably damaging Het
Itpr2 A T 6: 146,385,882 L157Q probably damaging Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lrrc72 G T 12: 36,208,657 T67K possibly damaging Het
Map2 T G 1: 66,415,845 I1298S probably damaging Het
Mroh2a T TN 1: 88,256,167 probably null Het
Ndst1 G A 18: 60,702,927 A428V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1369-ps1 T C 13: 21,116,003 Y104H possibly damaging Het
Olfr177 G T 16: 58,873,075 T25K probably benign Het
Olfr481 C T 7: 108,081,535 A247V probably benign Het
Plxna1 A G 6: 89,357,137 V170A probably damaging Het
Rfx6 G A 10: 51,718,208 probably null Het
Shprh G A 10: 11,186,862 D1238N probably damaging Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc9c1 A T 16: 45,577,899 I676F possibly damaging Het
Smoc1 A G 12: 81,168,255 D305G probably damaging Het
Spdef C T 17: 27,718,077 R184H probably damaging Het
Stxbp4 C T 11: 90,480,671 A535T probably benign Het
Tcp11l1 C G 2: 104,685,484 V345L probably benign Het
Ticam1 TC T 17: 56,269,969 probably null Het
Ttc28 A T 5: 111,100,712 Y177F probably benign Het
Ugt2b34 A T 5: 86,906,674 Y83N probably benign Het
Vmn2r30 G A 7: 7,334,149 R163C probably benign Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Other mutations in Hist1h2bj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02559:Hist1h2bj APN 13 22043363 missense possibly damaging 0.87
IGL02862:Hist1h2bj APN 13 22043345 missense possibly damaging 0.81
R4716:Hist1h2bj UTSW 13 22043363 missense possibly damaging 0.87
R4850:Hist1h2bj UTSW 13 22043251 unclassified probably benign
R4851:Hist1h2bj UTSW 13 22043251 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCCTTAGTGACAACTGTACGTTCCC -3'
(R):5'- TCACGAACGAGTTCATGATGCCC -3'

Sequencing Primer
(F):5'- TTGGGCCAAAGCCTATATGAC -3'
(R):5'- CATGGCCTTGGAGGAGATACC -3'
Posted On2013-06-11