Incidental Mutation 'R5767:Rcc2'
ID446321
Institutional Source Beutler Lab
Gene Symbol Rcc2
Ensembl Gene ENSMUSG00000040945
Gene Nameregulator of chromosome condensation 2
SynonymsTd60, 2610529N02Rik, 2610510H01Rik
MMRRC Submission 043367-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5767 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location140700541-140723220 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140715919 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 303 (C303S)
Ref Sequence ENSEMBL: ENSMUSP00000071163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038893] [ENSMUST00000071169]
Predicted Effect probably damaging
Transcript: ENSMUST00000038893
AA Change: C303S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038144
Gene: ENSMUSG00000040945
AA Change: C303S

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 41 50 N/A INTRINSIC
low complexity region 65 87 N/A INTRINSIC
Pfam:RCC1_2 148 179 6.5e-8 PFAM
Pfam:RCC1 166 215 2.7e-18 PFAM
Pfam:RCC1_2 202 231 5.4e-10 PFAM
Pfam:RCC1 218 267 8.5e-14 PFAM
Pfam:RCC1 270 343 2.9e-13 PFAM
Pfam:RCC1_2 330 359 6.2e-9 PFAM
Pfam:RCC1 347 397 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071169
AA Change: C303S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071163
Gene: ENSMUSG00000040945
AA Change: C303S

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 41 50 N/A INTRINSIC
low complexity region 65 87 N/A INTRINSIC
Pfam:RCC1_2 148 179 6.1e-8 PFAM
Pfam:RCC1 166 215 4.1e-19 PFAM
Pfam:RCC1_2 202 231 5.1e-10 PFAM
Pfam:RCC1 218 267 1.6e-12 PFAM
Pfam:RCC1 270 343 7.5e-13 PFAM
Pfam:RCC1_2 330 359 1.3e-8 PFAM
Pfam:RCC1 347 397 2.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175330
Meta Mutation Damage Score 0.2469 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine exchange factor that is active on RalA, a small GTPase. The encoded protein and RalA are both essential for proper kinetochore-microtubule function in early mitosis. This protein has been shown to be a biomarker for colorectal cancer. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 A T 10: 89,726,755 D87E probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Ano3 A T 2: 110,661,271 Y887N probably damaging Het
Arid4a A G 12: 71,060,093 D313G probably damaging Het
Armc2 A G 10: 42,011,927 V20A probably benign Het
C2 T A 17: 34,876,456 N171I possibly damaging Het
Cdh1 C A 8: 106,668,555 N865K probably damaging Het
Cep89 T A 7: 35,417,645 V224E probably damaging Het
Dennd2d C T 3: 106,487,815 probably benign Het
Diaph1 T A 18: 37,853,355 K1157N probably damaging Het
Dsg4 T A 18: 20,462,492 L584* probably null Het
Exoc4 G A 6: 33,918,432 A795T probably benign Het
Fbln5 A T 12: 101,765,209 I242N probably damaging Het
Gls2 A G 10: 128,205,221 H394R probably damaging Het
Gm27013 C T 6: 130,675,958 C847Y possibly damaging Het
Ifna5 C A 4: 88,835,799 T92K possibly damaging Het
Ireb2 A G 9: 54,900,516 M674V probably benign Het
Itga2 C T 13: 114,839,570 V1089M possibly damaging Het
Kctd16 A T 18: 40,258,869 Y170F probably benign Het
Kif15 A G 9: 123,013,974 N45D possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mink1 A G 11: 70,606,075 K420E possibly damaging Het
Ms4a14 G T 19: 11,302,027 Q1056K probably benign Het
Olfr1053 T A 2: 86,314,398 E296V probably damaging Het
Olfr175-ps1 T C 16: 58,823,953 Y252C probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Ovch2 T C 7: 107,781,978 E571G probably benign Het
Pmel T C 10: 128,714,381 V95A probably damaging Het
Ptger2 G T 14: 44,989,142 G60C probably benign Het
Ranbp2 T G 10: 58,476,825 S1122R probably benign Het
Rasal2 T C 1: 157,176,162 D309G probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpini1 C T 3: 75,613,081 probably benign Het
Sgo2a G T 1: 58,019,660 E1133* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smarcc1 G A 9: 110,132,183 probably benign Het
Tbcd A G 11: 121,592,692 E749G probably benign Het
Tmc3 G A 7: 83,599,982 A260T probably benign Het
Tnfrsf21 A G 17: 43,037,659 Y54C probably damaging Het
Uhrf1bp1l A G 10: 89,787,199 D312G possibly damaging Het
Urb1 T A 16: 90,776,163 M994L probably benign Het
Usp14 A T 18: 10,009,935 probably benign Het
Vps13a T C 19: 16,664,564 Y2233C probably damaging Het
Wdr66 G A 5: 123,298,521 V1038I probably benign Het
Wnt2 G T 6: 17,990,028 A290E probably damaging Het
Zc3h8 A T 2: 128,930,892 C225* probably null Het
Other mutations in Rcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Rcc2 APN 4 140720591 missense possibly damaging 0.85
IGL02486:Rcc2 APN 4 140710362 missense probably damaging 1.00
PIT4445001:Rcc2 UTSW 4 140721149 missense possibly damaging 0.84
R0637:Rcc2 UTSW 4 140717744 splice site probably benign
R1856:Rcc2 UTSW 4 140720604 missense probably benign 0.17
R2107:Rcc2 UTSW 4 140721185 missense probably damaging 1.00
R2152:Rcc2 UTSW 4 140717117 missense probably damaging 1.00
R4809:Rcc2 UTSW 4 140717042 missense probably damaging 1.00
R5004:Rcc2 UTSW 4 140717666 missense possibly damaging 0.86
R5229:Rcc2 UTSW 4 140717029 missense probably damaging 1.00
R5384:Rcc2 UTSW 4 140720566 nonsense probably null
R5840:Rcc2 UTSW 4 140712138 missense possibly damaging 0.95
R5909:Rcc2 UTSW 4 140717068 missense probably damaging 1.00
R6056:Rcc2 UTSW 4 140717024 missense possibly damaging 0.73
R6698:Rcc2 UTSW 4 140702275 missense probably benign 0.00
R7086:Rcc2 UTSW 4 140707969 missense probably benign 0.20
R7252:Rcc2 UTSW 4 140702275 missense probably benign 0.00
R7393:Rcc2 UTSW 4 140717030 missense probably damaging 1.00
R8054:Rcc2 UTSW 4 140702275 missense probably benign 0.00
R8055:Rcc2 UTSW 4 140702275 missense probably benign 0.00
R8056:Rcc2 UTSW 4 140702275 missense probably benign 0.00
R8057:Rcc2 UTSW 4 140702275 missense probably benign 0.00
R8058:Rcc2 UTSW 4 140702275 missense probably benign 0.00
R8501:Rcc2 UTSW 4 140715926 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CGGTGTTAGGTACCAGCTTG -3'
(R):5'- GTCTGCAAGTTGTCTGCAGAGG -3'

Sequencing Primer
(F):5'- CTTGTGAGCAACTGGGCAGAC -3'
(R):5'- TCAGCCAAATGACATAGCTTGAG -3'
Posted On2016-11-21