Incidental Mutation 'R5767:Wdr66'
ID446322
Institutional Source Beutler Lab
Gene Symbol Wdr66
Ensembl Gene ENSMUSG00000029442
Gene NameWD repeat domain 66
Synonyms
MMRRC Submission 043367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5767 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location123252102-123327484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123298521 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1038 (V1038I)
Ref Sequence ENSEMBL: ENSMUSP00000113309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069311] [ENSMUST00000121964] [ENSMUST00000163092] [ENSMUST00000170536]
Predicted Effect probably benign
Transcript: ENSMUST00000069311
AA Change: V64I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069782
Gene: ENSMUSG00000029442
AA Change: V64I

DomainStartEndE-ValueType
Blast:WD40 54 95 3e-24 BLAST
SCOP:d1exra_ 157 267 3e-4 SMART
low complexity region 300 311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121964
AA Change: V1038I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000113309
Gene: ENSMUSG00000029442
AA Change: V1038I

DomainStartEndE-ValueType
coiled coil region 9 160 N/A INTRINSIC
coiled coil region 243 299 N/A INTRINSIC
WD40 437 478 1.58e-2 SMART
WD40 481 525 6.16e0 SMART
Blast:WD40 532 572 2e-15 BLAST
Blast:WD40 584 623 5e-17 BLAST
low complexity region 627 641 N/A INTRINSIC
WD40 643 677 7.64e1 SMART
Blast:WD40 686 742 1e-13 BLAST
WD40 745 784 8.62e-4 SMART
WD40 789 827 1.19e1 SMART
WD40 832 871 5.97e-1 SMART
WD40 880 923 1.23e2 SMART
WD40 1030 1070 1.15e0 SMART
low complexity region 1274 1285 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143629
Predicted Effect probably benign
Transcript: ENSMUST00000150155
Predicted Effect probably benign
Transcript: ENSMUST00000163092
SMART Domains Protein: ENSMUSP00000126995
Gene: ENSMUSG00000029442

DomainStartEndE-ValueType
Blast:WD40 1 28 3e-10 BLAST
Blast:WD40 35 75 2e-15 BLAST
Blast:WD40 87 126 3e-17 BLAST
low complexity region 130 144 N/A INTRINSIC
WD40 146 180 7.64e1 SMART
Blast:WD40 183 246 2e-14 BLAST
WD40 248 287 8.62e-4 SMART
WD40 292 330 1.19e1 SMART
WD40 335 374 5.97e-1 SMART
WD40 383 426 1.23e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170536
SMART Domains Protein: ENSMUSP00000129769
Gene: ENSMUSG00000029442

DomainStartEndE-ValueType
WD40 42 86 3.18e1 SMART
Blast:WD40 93 133 1e-15 BLAST
Blast:WD40 145 184 3e-17 BLAST
low complexity region 188 202 N/A INTRINSIC
WD40 204 238 7.64e1 SMART
Blast:WD40 241 304 3e-14 BLAST
WD40 306 345 8.62e-4 SMART
WD40 350 388 1.19e1 SMART
WD40 393 432 5.97e-1 SMART
WD40 441 484 1.23e2 SMART
Blast:WD40 490 535 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197763
Meta Mutation Damage Score 0.0843 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member appears to function in the determination of mean platelet volume (MPV), and polymorphisms in this gene have been associated with variance in MPV. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 A T 10: 89,726,755 D87E probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Ano3 A T 2: 110,661,271 Y887N probably damaging Het
Arid4a A G 12: 71,060,093 D313G probably damaging Het
Armc2 A G 10: 42,011,927 V20A probably benign Het
C2 T A 17: 34,876,456 N171I possibly damaging Het
Cdh1 C A 8: 106,668,555 N865K probably damaging Het
Cep89 T A 7: 35,417,645 V224E probably damaging Het
Dennd2d C T 3: 106,487,815 probably benign Het
Diaph1 T A 18: 37,853,355 K1157N probably damaging Het
Dsg4 T A 18: 20,462,492 L584* probably null Het
Exoc4 G A 6: 33,918,432 A795T probably benign Het
Fbln5 A T 12: 101,765,209 I242N probably damaging Het
Gls2 A G 10: 128,205,221 H394R probably damaging Het
Gm27013 C T 6: 130,675,958 C847Y possibly damaging Het
Ifna5 C A 4: 88,835,799 T92K possibly damaging Het
Ireb2 A G 9: 54,900,516 M674V probably benign Het
Itga2 C T 13: 114,839,570 V1089M possibly damaging Het
Kctd16 A T 18: 40,258,869 Y170F probably benign Het
Kif15 A G 9: 123,013,974 N45D possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mink1 A G 11: 70,606,075 K420E possibly damaging Het
Ms4a14 G T 19: 11,302,027 Q1056K probably benign Het
Olfr1053 T A 2: 86,314,398 E296V probably damaging Het
Olfr175-ps1 T C 16: 58,823,953 Y252C probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Ovch2 T C 7: 107,781,978 E571G probably benign Het
Pmel T C 10: 128,714,381 V95A probably damaging Het
Ptger2 G T 14: 44,989,142 G60C probably benign Het
Ranbp2 T G 10: 58,476,825 S1122R probably benign Het
Rasal2 T C 1: 157,176,162 D309G probably damaging Het
Rcc2 T A 4: 140,715,919 C303S probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpini1 C T 3: 75,613,081 probably benign Het
Sgo2a G T 1: 58,019,660 E1133* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smarcc1 G A 9: 110,132,183 probably benign Het
Tbcd A G 11: 121,592,692 E749G probably benign Het
Tmc3 G A 7: 83,599,982 A260T probably benign Het
Tnfrsf21 A G 17: 43,037,659 Y54C probably damaging Het
Uhrf1bp1l A G 10: 89,787,199 D312G possibly damaging Het
Urb1 T A 16: 90,776,163 M994L probably benign Het
Usp14 A T 18: 10,009,935 probably benign Het
Vps13a T C 19: 16,664,564 Y2233C probably damaging Het
Wnt2 G T 6: 17,990,028 A290E probably damaging Het
Zc3h8 A T 2: 128,930,892 C225* probably null Het
Other mutations in Wdr66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Wdr66 APN 5 123274177 missense probably damaging 1.00
IGL01090:Wdr66 APN 5 123279989 splice site probably benign
IGL01387:Wdr66 APN 5 123283546 missense probably damaging 1.00
IGL01432:Wdr66 APN 5 123279952 missense possibly damaging 0.88
IGL01642:Wdr66 APN 5 123288698 missense possibly damaging 0.77
IGL01720:Wdr66 APN 5 123322494 missense probably benign 0.07
IGL02104:Wdr66 APN 5 123302698 nonsense probably null
IGL02160:Wdr66 APN 5 123256018 missense unknown
IGL02238:Wdr66 APN 5 123302423 missense probably damaging 1.00
IGL02820:Wdr66 APN 5 123254636 unclassified probably benign
IGL03183:Wdr66 APN 5 123254619 unclassified probably benign
R0078:Wdr66 UTSW 5 123298570 missense probably benign 0.04
R0207:Wdr66 UTSW 5 123283447 missense probably damaging 0.98
R0411:Wdr66 UTSW 5 123290054 missense probably damaging 1.00
R0414:Wdr66 UTSW 5 123287413 splice site probably null
R0722:Wdr66 UTSW 5 123256185 missense probably damaging 1.00
R1169:Wdr66 UTSW 5 123254610 small deletion probably benign
R1527:Wdr66 UTSW 5 123287345 missense probably benign 0.19
R1924:Wdr66 UTSW 5 123302739 missense possibly damaging 0.67
R2022:Wdr66 UTSW 5 123273790 missense probably benign 0.29
R2110:Wdr66 UTSW 5 123254375 unclassified probably benign
R2112:Wdr66 UTSW 5 123254375 unclassified probably benign
R2147:Wdr66 UTSW 5 123256191 missense probably benign 0.01
R2258:Wdr66 UTSW 5 123283348 splice site probably null
R2407:Wdr66 UTSW 5 123289969 missense probably benign 0.11
R2418:Wdr66 UTSW 5 123254268 unclassified probably benign
R2497:Wdr66 UTSW 5 123283369 missense probably damaging 1.00
R2509:Wdr66 UTSW 5 123256106 missense probably benign 0.00
R3437:Wdr66 UTSW 5 123254372 unclassified probably benign
R3730:Wdr66 UTSW 5 123326568 missense possibly damaging 0.70
R3800:Wdr66 UTSW 5 123254721 unclassified probably benign
R4018:Wdr66 UTSW 5 123322454 missense probably benign 0.04
R4181:Wdr66 UTSW 5 123293810 missense probably benign 0.33
R4302:Wdr66 UTSW 5 123293810 missense probably benign 0.33
R4640:Wdr66 UTSW 5 123302432 missense probably benign 0.00
R4701:Wdr66 UTSW 5 123322613 missense probably benign 0.00
R4799:Wdr66 UTSW 5 123302772 missense probably benign 0.04
R4812:Wdr66 UTSW 5 123287305 missense probably benign 0.01
R4922:Wdr66 UTSW 5 123256053 missense probably benign 0.00
R5123:Wdr66 UTSW 5 123273633 start gained probably benign
R5314:Wdr66 UTSW 5 123322563 missense probably benign 0.01
R5445:Wdr66 UTSW 5 123287177 missense probably damaging 1.00
R5458:Wdr66 UTSW 5 123254445 unclassified probably benign
R5462:Wdr66 UTSW 5 123298632 critical splice donor site probably null
R5514:Wdr66 UTSW 5 123287766 critical splice donor site probably null
R5600:Wdr66 UTSW 5 123288698 missense possibly damaging 0.77
R5635:Wdr66 UTSW 5 123322572 missense probably benign 0.25
R5943:Wdr66 UTSW 5 123286357 missense probably benign 0.13
R6000:Wdr66 UTSW 5 123254372 unclassified probably benign
R6030:Wdr66 UTSW 5 123274204 missense probably damaging 0.97
R6030:Wdr66 UTSW 5 123274204 missense probably damaging 0.97
R6293:Wdr66 UTSW 5 123322448 missense probably damaging 1.00
R6354:Wdr66 UTSW 5 123302755 missense probably damaging 0.99
R6356:Wdr66 UTSW 5 123254666 unclassified probably benign
R6427:Wdr66 UTSW 5 123326533 missense probably damaging 1.00
R6896:Wdr66 UTSW 5 123278358 missense possibly damaging 0.81
R6909:Wdr66 UTSW 5 123287752 missense probably damaging 1.00
R7503:Wdr66 UTSW 5 123297458 nonsense probably null
R7707:Wdr66 UTSW 5 123253887 missense probably benign 0.00
R7715:Wdr66 UTSW 5 123262134 missense probably damaging 1.00
R7809:Wdr66 UTSW 5 123264831 missense probably damaging 1.00
R7819:Wdr66 UTSW 5 123254259 unclassified probably benign
R7842:Wdr66 UTSW 5 123254424 missense unknown
R7898:Wdr66 UTSW 5 123322454 missense probably damaging 0.99
R7967:Wdr66 UTSW 5 123283516 missense possibly damaging 0.89
R8004:Wdr66 UTSW 5 123254450 missense unknown
R8068:Wdr66 UTSW 5 123256166 missense not run
R8141:Wdr66 UTSW 5 123286430 missense possibly damaging 0.83
R8222:Wdr66 UTSW 5 123302423 missense probably damaging 1.00
R8242:Wdr66 UTSW 5 123273851 missense possibly damaging 0.89
R8303:Wdr66 UTSW 5 123322587 missense probably damaging 0.99
R8323:Wdr66 UTSW 5 123297525 missense probably benign 0.16
R8773:Wdr66 UTSW 5 123273850 missense probably benign 0.12
R8869:Wdr66 UTSW 5 123322442 missense possibly damaging 0.48
R8881:Wdr66 UTSW 5 123324375 missense probably damaging 1.00
R8921:Wdr66 UTSW 5 123286418 missense possibly damaging 0.71
RF007:Wdr66 UTSW 5 123254254 small insertion probably benign
RF010:Wdr66 UTSW 5 123274161 critical splice acceptor site probably benign
RF015:Wdr66 UTSW 5 123254242 small insertion probably benign
RF015:Wdr66 UTSW 5 123274161 critical splice acceptor site probably benign
RF017:Wdr66 UTSW 5 123253890 small insertion probably benign
RF024:Wdr66 UTSW 5 123253883 small insertion probably benign
RF024:Wdr66 UTSW 5 123253888 small insertion probably benign
RF024:Wdr66 UTSW 5 123253889 small insertion probably benign
X0062:Wdr66 UTSW 5 123274237 missense probably benign 0.29
X0066:Wdr66 UTSW 5 123288647 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCCTCCAAAGGATGCTCTTC -3'
(R):5'- AGCAAAGGCAGTTAAAAGTGTTCC -3'

Sequencing Primer
(F):5'- GCTGGGAAAAATCTAATTTGCATGG -3'
(R):5'- GGGTGGCTCACAATGACATTAACTC -3'
Posted On2016-11-21