Incidental Mutation 'R5767:Wnt2'
ID446323
Institutional Source Beutler Lab
Gene Symbol Wnt2
Ensembl Gene ENSMUSG00000010797
Gene Namewingless-type MMTV integration site family, member 2
Synonymsm-irp, Irp, 2610510E18Rik, Int1l1, Mirp, Wnt2a, Wnt-2
MMRRC Submission 043367-MU
Accession Numbers

Genbank: NM_023653.5; Ensembl: ENSMUST00000010941

Is this an essential gene? Possibly non essential (E-score: 0.458) question?
Stock #R5767 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location17988940-18030585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 17990028 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 290 (A290E)
Ref Sequence ENSEMBL: ENSMUSP00000010941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010941]
Predicted Effect probably damaging
Transcript: ENSMUST00000010941
AA Change: A290E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000010941
Gene: ENSMUSG00000010797
AA Change: A290E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
WNT1 43 349 5.1e-213 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the WNT gene family. The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit impaired placental vascularization, runting and 50% perinatal mortality resulting from difficulties in breathing and nursing. Survivors of the perinatal period tend to recover, and adults are healthy and fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 A T 10: 89,726,755 D87E probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Ano3 A T 2: 110,661,271 Y887N probably damaging Het
Arid4a A G 12: 71,060,093 D313G probably damaging Het
Armc2 A G 10: 42,011,927 V20A probably benign Het
C2 T A 17: 34,876,456 N171I possibly damaging Het
Cdh1 C A 8: 106,668,555 N865K probably damaging Het
Cep89 T A 7: 35,417,645 V224E probably damaging Het
Dennd2d C T 3: 106,487,815 probably benign Het
Diaph1 T A 18: 37,853,355 K1157N probably damaging Het
Dsg4 T A 18: 20,462,492 L584* probably null Het
Exoc4 G A 6: 33,918,432 A795T probably benign Het
Fbln5 A T 12: 101,765,209 I242N probably damaging Het
Gls2 A G 10: 128,205,221 H394R probably damaging Het
Gm27013 C T 6: 130,675,958 C847Y possibly damaging Het
Ifna5 C A 4: 88,835,799 T92K possibly damaging Het
Ireb2 A G 9: 54,900,516 M674V probably benign Het
Itga2 C T 13: 114,839,570 V1089M possibly damaging Het
Kctd16 A T 18: 40,258,869 Y170F probably benign Het
Kif15 A G 9: 123,013,974 N45D possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mink1 A G 11: 70,606,075 K420E possibly damaging Het
Ms4a14 G T 19: 11,302,027 Q1056K probably benign Het
Olfr1053 T A 2: 86,314,398 E296V probably damaging Het
Olfr175-ps1 T C 16: 58,823,953 Y252C probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Ovch2 T C 7: 107,781,978 E571G probably benign Het
Pmel T C 10: 128,714,381 V95A probably damaging Het
Ptger2 G T 14: 44,989,142 G60C probably benign Het
Ranbp2 T G 10: 58,476,825 S1122R probably benign Het
Rasal2 T C 1: 157,176,162 D309G probably damaging Het
Rcc2 T A 4: 140,715,919 C303S probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpini1 C T 3: 75,613,081 probably benign Het
Sgo2a G T 1: 58,019,660 E1133* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smarcc1 G A 9: 110,132,183 probably benign Het
Tbcd A G 11: 121,592,692 E749G probably benign Het
Tmc3 G A 7: 83,599,982 A260T probably benign Het
Tnfrsf21 A G 17: 43,037,659 Y54C probably damaging Het
Uhrf1bp1l A G 10: 89,787,199 D312G possibly damaging Het
Urb1 T A 16: 90,776,163 M994L probably benign Het
Usp14 A T 18: 10,009,935 probably benign Het
Vps13a T C 19: 16,664,564 Y2233C probably damaging Het
Wdr66 G A 5: 123,298,521 V1038I probably benign Het
Zc3h8 A T 2: 128,930,892 C225* probably null Het
Other mutations in Wnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03264:Wnt2 APN 6 17989960 missense probably benign 0.22
1mM(1):Wnt2 UTSW 6 18008623 missense probably damaging 1.00
R1165:Wnt2 UTSW 6 17989947 missense probably benign
R1771:Wnt2 UTSW 6 18008697 missense probably damaging 0.97
R1782:Wnt2 UTSW 6 18008640 missense possibly damaging 0.65
R1836:Wnt2 UTSW 6 18023235 missense probably damaging 1.00
R1921:Wnt2 UTSW 6 18030253 missense unknown
R2009:Wnt2 UTSW 6 18030209 missense probably damaging 0.98
R3749:Wnt2 UTSW 6 18023168 missense probably benign 0.00
R4831:Wnt2 UTSW 6 18023286 missense probably benign 0.19
R4888:Wnt2 UTSW 6 18023126 missense possibly damaging 0.89
R4924:Wnt2 UTSW 6 18023240 missense probably damaging 1.00
R5121:Wnt2 UTSW 6 18023126 missense possibly damaging 0.89
R5660:Wnt2 UTSW 6 18028146 missense probably benign 0.09
R6005:Wnt2 UTSW 6 18030323 start gained probably benign
R6670:Wnt2 UTSW 6 18028092 missense possibly damaging 0.90
R7205:Wnt2 UTSW 6 18028047 missense probably benign 0.11
R7711:Wnt2 UTSW 6 17990037 missense probably benign 0.44
R7732:Wnt2 UTSW 6 18023336 missense probably damaging 1.00
R8249:Wnt2 UTSW 6 18030285 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- CTCTGCTGAGGTCATGTAGG -3'
(R):5'- TCAGCTACAACACAGGGGAC -3'

Sequencing Primer
(F):5'- AGGTCATGTAGGCGTCGC -3'
(R):5'- TCAGCTACAACACAGGGGACTATAG -3'
Posted On2016-11-21