Incidental Mutation 'R5767:Gm27013'
ID446325
Institutional Source Beutler Lab
Gene Symbol Gm27013
Ensembl Gene ENSMUSG00000098025
Gene Namepredicted gene, 27013
Synonyms
MMRRC Submission 043367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R5767 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location130519764-130546306 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130675958 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 847 (C847Y)
Gene Model predicted gene model for transcript(s):
Predicted Effect possibly damaging
Transcript: ENSMUST00000182643
AA Change: C847Y

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138716
Gene: ENSMUSG00000098137
AA Change: C847Y

DomainStartEndE-ValueType
KRAB 8 68 3.39e-35 SMART
ZnF_C2H2 453 503 1.83e2 SMART
ZnF_C2H2 509 531 6.99e-5 SMART
ZnF_C2H2 537 559 1.4e-4 SMART
ZnF_C2H2 565 587 1.6e-4 SMART
ZnF_C2H2 593 615 1.08e-5 SMART
ZnF_C2H2 621 643 1.2e-3 SMART
ZnF_C2H2 649 671 1.5e-4 SMART
ZnF_C2H2 677 699 1.58e-3 SMART
ZnF_C2H2 705 727 2.61e-4 SMART
ZnF_C2H2 733 755 4.79e-3 SMART
ZnF_C2H2 761 783 4.61e-5 SMART
ZnF_C2H2 789 811 1.13e-4 SMART
ZnF_C2H2 817 839 3.16e-3 SMART
ZnF_C2H2 845 867 1.28e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205067
Meta Mutation Damage Score 0.7300 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 A T 10: 89,726,755 D87E probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Ano3 A T 2: 110,661,271 Y887N probably damaging Het
Arid4a A G 12: 71,060,093 D313G probably damaging Het
Armc2 A G 10: 42,011,927 V20A probably benign Het
C2 T A 17: 34,876,456 N171I possibly damaging Het
Cdh1 C A 8: 106,668,555 N865K probably damaging Het
Cep89 T A 7: 35,417,645 V224E probably damaging Het
Dennd2d C T 3: 106,487,815 probably benign Het
Diaph1 T A 18: 37,853,355 K1157N probably damaging Het
Dsg4 T A 18: 20,462,492 L584* probably null Het
Exoc4 G A 6: 33,918,432 A795T probably benign Het
Fbln5 A T 12: 101,765,209 I242N probably damaging Het
Gls2 A G 10: 128,205,221 H394R probably damaging Het
Ifna5 C A 4: 88,835,799 T92K possibly damaging Het
Ireb2 A G 9: 54,900,516 M674V probably benign Het
Itga2 C T 13: 114,839,570 V1089M possibly damaging Het
Kctd16 A T 18: 40,258,869 Y170F probably benign Het
Kif15 A G 9: 123,013,974 N45D possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mink1 A G 11: 70,606,075 K420E possibly damaging Het
Ms4a14 G T 19: 11,302,027 Q1056K probably benign Het
Olfr1053 T A 2: 86,314,398 E296V probably damaging Het
Olfr175-ps1 T C 16: 58,823,953 Y252C probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Ovch2 T C 7: 107,781,978 E571G probably benign Het
Pmel T C 10: 128,714,381 V95A probably damaging Het
Ptger2 G T 14: 44,989,142 G60C probably benign Het
Ranbp2 T G 10: 58,476,825 S1122R probably benign Het
Rasal2 T C 1: 157,176,162 D309G probably damaging Het
Rcc2 T A 4: 140,715,919 C303S probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpini1 C T 3: 75,613,081 probably benign Het
Sgo2a G T 1: 58,019,660 E1133* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smarcc1 G A 9: 110,132,183 probably benign Het
Tbcd A G 11: 121,592,692 E749G probably benign Het
Tmc3 G A 7: 83,599,982 A260T probably benign Het
Tnfrsf21 A G 17: 43,037,659 Y54C probably damaging Het
Uhrf1bp1l A G 10: 89,787,199 D312G possibly damaging Het
Urb1 T A 16: 90,776,163 M994L probably benign Het
Usp14 A T 18: 10,009,935 probably benign Het
Vps13a T C 19: 16,664,564 Y2233C probably damaging Het
Wdr66 G A 5: 123,298,521 V1038I probably benign Het
Wnt2 G T 6: 17,990,028 A290E probably damaging Het
Zc3h8 A T 2: 128,930,892 C225* probably null Het
Other mutations in Gm27013
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4175:Gm27013 UTSW 6 130677147 missense probably benign 0.00
R4229:Gm27013 UTSW 6 130677345 missense possibly damaging 0.89
R4408:Gm27013 UTSW 6 130677765 missense possibly damaging 0.90
R4585:Gm27013 UTSW 6 130521040 unclassified noncoding transcript
R4586:Gm27013 UTSW 6 130521040 unclassified noncoding transcript
R4823:Gm27013 UTSW 6 130522223 exon noncoding transcript
R4840:Gm27013 UTSW 6 130678116 missense probably benign 0.00
R4842:Gm27013 UTSW 6 130520737 unclassified noncoding transcript
R4943:Gm27013 UTSW 6 130676200 nonsense probably null
R4998:Gm27013 UTSW 6 130676538 missense probably damaging 0.98
R5087:Gm27013 UTSW 6 130677670 missense probably damaging 0.98
R5271:Gm27013 UTSW 6 130676915 missense probably damaging 1.00
R5507:Gm27013 UTSW 6 130675979 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGCTTCATGATCTGAGTGT -3'
(R):5'- TTAAAGTTCACCAGCGAATTCATACAG -3'

Sequencing Primer
(F):5'- AGTGTTGTGTAAAGGATTTGCCAC -3'
(R):5'- CTCGGAGCTTAAAGTTCACTACAG -3'
Posted On2016-11-21