Mutagenetix > Incidental Mutations

Incidental Mutation 'R5767:Cep89'

446326

Institutional Source

Beutler Lab

Gene Symbol

Cep89

Ensembl Gene

ENSMUSG00000023072

Gene Name

centrosomal protein 89

Synonyms

Ccdc123, 2610507L03Rik

MMRRC Submission

043367-MU

Accession Numbers

Genbank: NM_028120; MGI: 1919390

Is this an essential gene?

Probably non essential (E-score: 0.133) question?

Stock #

R5767 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

35397035-35438689 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 35417645 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 224 (V224E)

Ref Sequence

ENSEMBL: ENSMUSP00000078383 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079414] [ENSMUST00000141704] [ENSMUST00000206230]

Predicted Effect

probably damaging
Transcript: ENSMUST00000079414
AA Change: V224E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000078383
Gene: ENSMUSG00000023072
AA Change: V224E

Domain	Start	End	E-Value	Type
low complexity region	27	62	N/A	INTRINSIC
low complexity region	181	190	N/A	INTRINSIC
coiled coil region	252	291	N/A	INTRINSIC
coiled coil region	372	598	N/A	INTRINSIC
coiled coil region	670	732	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141704
AA Change: V224E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000121393
Gene: ENSMUSG00000023072
AA Change: V224E

Domain	Start	End	E-Value	Type
low complexity region	27	62	N/A	INTRINSIC
low complexity region	181	190	N/A	INTRINSIC
coiled coil region	252	291	N/A	INTRINSIC
coiled coil region	372	598	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148166

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152020

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155137

Predicted Effect

probably benign
Transcript: ENSMUST00000206230

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

98% (52/53)

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr6	A	T	10: 89,726,755	D87E	probably damaging	Het
AI429214	TCCCTGATGAAC	TC	8: 36,994,229		probably null	Het
Ano3	A	T	2: 110,661,271	Y887N	probably damaging	Het
Arid4a	A	G	12: 71,060,093	D313G	probably damaging	Het
Armc2	A	G	10: 42,011,927	V20A	probably benign	Het
C2	T	A	17: 34,876,456	N171I	possibly damaging	Het
Cdh1	C	A	8: 106,668,555	N865K	probably damaging	Het
Dennd2d	C	T	3: 106,487,815		probably benign	Het
Diaph1	T	A	18: 37,853,355	K1157N	probably damaging	Het
Dsg4	T	A	18: 20,462,492	L584*	probably null	Het
Exoc4	G	A	6: 33,918,432	A795T	probably benign	Het
Fbln5	A	T	12: 101,765,209	I242N	probably damaging	Het
Gls2	A	G	10: 128,205,221	H394R	probably damaging	Het
Gm27013	C	T	6: 130,675,958	C847Y	possibly damaging	Het
Ifna5	C	A	4: 88,835,799	T92K	possibly damaging	Het
Ireb2	A	G	9: 54,900,516	M674V	probably benign	Het
Itga2	C	T	13: 114,839,570	V1089M	possibly damaging	Het
Kctd16	A	T	18: 40,258,869	Y170F	probably benign	Het
Kif15	A	G	9: 123,013,974	N45D	possibly damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Mink1	A	G	11: 70,606,075	K420E	possibly damaging	Het
Ms4a14	G	T	19: 11,302,027	Q1056K	probably benign	Het
Olfr1053	T	A	2: 86,314,398	E296V	probably damaging	Het
Olfr175-ps1	T	C	16: 58,823,953	Y252C	probably benign	Het
Olfr738	T	C	14: 50,413,778	V78A	possibly damaging	Het
Ovch2	T	C	7: 107,781,978	E571G	probably benign	Het
Pmel	T	C	10: 128,714,381	V95A	probably damaging	Het
Ptger2	G	T	14: 44,989,142	G60C	probably benign	Het
Ranbp2	T	G	10: 58,476,825	S1122R	probably benign	Het
Rasal2	T	C	1: 157,176,162	D309G	probably damaging	Het
Rcc2	T	A	4: 140,715,919	C303S	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Serpini1	C	T	3: 75,613,081		probably benign	Het
Sgo2a	G	T	1: 58,019,660	E1133*	probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Smarcc1	G	A	9: 110,132,183		probably benign	Het
Tbcd	A	G	11: 121,592,692	E749G	probably benign	Het
Tmc3	G	A	7: 83,599,982	A260T	probably benign	Het
Tnfrsf21	A	G	17: 43,037,659	Y54C	probably damaging	Het
Uhrf1bp1l	A	G	10: 89,787,199	D312G	possibly damaging	Het
Urb1	T	A	16: 90,776,163	M994L	probably benign	Het
Usp14	A	T	18: 10,009,935		probably benign	Het
Vps13a	T	C	19: 16,664,564	Y2233C	probably damaging	Het
Wdr66	G	A	5: 123,298,521	V1038I	probably benign	Het
Wnt2	G	T	6: 17,990,028	A290E	probably damaging	Het
Zc3h8	A	T	2: 128,930,892	C225*	probably null	Het

Other mutations in Cep89

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00784:Cep89	APN	7	35405707	missense	possibly damaging	0.92
IGL01546:Cep89	APN	7	35420900	missense	probably damaging	1.00
IGL02001:Cep89	APN	7	35403007	splice site	probably benign
IGL02141:Cep89	APN	7	35420924	missense	probably damaging	1.00
IGL02468:Cep89	APN	7	35403152	missense	probably benign	0.35
IGL02507:Cep89	APN	7	35435565	missense	probably damaging	1.00
IGL02612:Cep89	APN	7	35424655	critical splice acceptor site	probably null
IGL03324:Cep89	APN	7	35424653	intron	probably benign
IGL03396:Cep89	APN	7	35429178	missense	probably benign	0.05
3-1:Cep89	UTSW	7	35424722	missense	probably damaging	0.99
FR4304:Cep89	UTSW	7	35409641	utr 3 prime	probably benign
FR4976:Cep89	UTSW	7	35409641	utr 3 prime	probably benign
K2124:Cep89	UTSW	7	35420972	splice site	probably benign
R0127:Cep89	UTSW	7	35428262	missense	possibly damaging	0.92
R0416:Cep89	UTSW	7	35416402	unclassified	probably benign
R0609:Cep89	UTSW	7	35435530	missense	probably damaging	1.00
R1442:Cep89	UTSW	7	35418211	splice site	probably benign
R1468:Cep89	UTSW	7	35420963	splice site	probably null
R1468:Cep89	UTSW	7	35420963	splice site	probably null
R1661:Cep89	UTSW	7	35417680	missense	possibly damaging	0.66
R3981:Cep89	UTSW	7	35438383	missense	probably damaging	1.00
R4414:Cep89	UTSW	7	35416397	unclassified	probably benign
R4700:Cep89	UTSW	7	35438437	missense	probably benign	0.05
R4963:Cep89	UTSW	7	35403152	missense	probably benign	0.35
R4968:Cep89	UTSW	7	35409630	missense	possibly damaging	0.90
R4972:Cep89	UTSW	7	35432552	missense	probably damaging	1.00
R5578:Cep89	UTSW	7	35409642	unclassified	probably benign
R5809:Cep89	UTSW	7	35417726	missense	probably damaging	0.97
R5890:Cep89	UTSW	7	35429162	missense	probably damaging	0.99
R6290:Cep89	UTSW	7	35420263	missense	probably damaging	1.00
R6361:Cep89	UTSW	7	35398047	missense	probably damaging	1.00
R6627:Cep89	UTSW	7	35427747	missense	possibly damaging	0.90
R7272:Cep89	UTSW	7	35438463	missense	probably benign	0.03
R7340:Cep89	UTSW	7	35429928	missense	probably damaging	0.97
R7341:Cep89	UTSW	7	35429928	missense	probably damaging	0.97
R7347:Cep89	UTSW	7	35429928	missense	probably damaging	0.97
R7348:Cep89	UTSW	7	35429928	missense	probably damaging	0.97
R7365:Cep89	UTSW	7	35429928	missense	probably damaging	0.97
R7366:Cep89	UTSW	7	35429928	missense	probably damaging	0.97
R7394:Cep89	UTSW	7	35429928	missense	probably damaging	0.97
R7399:Cep89	UTSW	7	35438378	missense	probably damaging	1.00
R7422:Cep89	UTSW	7	35428247	missense	probably damaging	1.00
R7792:Cep89	UTSW	7	35429928	missense	probably damaging	0.97
R7793:Cep89	UTSW	7	35429928	missense	probably damaging	0.97
R7819:Cep89	UTSW	7	35432543	missense	probably benign	0.07
R7860:Cep89	UTSW	7	35414145	missense	possibly damaging	0.63
R7899:Cep89	UTSW	7	35429928	missense	probably damaging	0.97
R8336:Cep89	UTSW	7	35427716	nonsense	probably null
R8669:Cep89	UTSW	7	35429177	missense	probably benign	0.04
V7732:Cep89	UTSW	7	35403098	missense	probably damaging	1.00
Z1177:Cep89	UTSW	7	35397081	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTTTGGACACCAGGGACAC -3'
(R):5'- TGTCCCTTAATAATGGTGCCAGG -3'

Sequencing Primer
(F):5'- AGGGACACGGCCTCAGG -3'
(R):5'- TCCTGACAGGAAGCCTTTTC -3'

Posted On

2016-11-21