Incidental Mutation 'R5767:Cdh1'
ID446331
Institutional Source Beutler Lab
Gene Symbol Cdh1
Ensembl Gene ENSMUSG00000000303
Gene Namecadherin 1
SynonymsEcad, UM, uvomorulin, E-cad, L-CAM, E-cadherin
MMRRC Submission 043367-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5767 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location106603351-106670246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 106668555 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 865 (N865K)
Ref Sequence ENSEMBL: ENSMUSP00000132112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000312] [ENSMUST00000167688]
Predicted Effect probably damaging
Transcript: ENSMUST00000000312
AA Change: N865K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000312
Gene: ENSMUSG00000000303
AA Change: N865K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Cadherin_pro 29 118 3.42e-36 SMART
low complexity region 123 131 N/A INTRINSIC
CA 179 262 2.27e-14 SMART
CA 286 375 3.18e-27 SMART
CA 398 487 2e-10 SMART
CA 510 595 1.49e-18 SMART
Pfam:Cadherin 600 688 5.3e-11 PFAM
transmembrane domain 711 733 N/A INTRINSIC
Pfam:Cadherin_C 734 881 1.3e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167688
AA Change: N865K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132112
Gene: ENSMUSG00000000303
AA Change: N865K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Cadherin_pro 29 118 3.42e-36 SMART
low complexity region 123 131 N/A INTRINSIC
CA 179 262 2.27e-14 SMART
CA 286 375 3.18e-27 SMART
CA 398 487 2e-10 SMART
CA 510 595 1.49e-18 SMART
Pfam:Cadherin 600 688 7.1e-10 PFAM
transmembrane domain 711 733 N/A INTRINSIC
Pfam:Cadherin_C 738 880 3.9e-50 PFAM
Meta Mutation Damage Score 0.5334 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This gene encodes E-cadherin, a calcium-dependent cell adhesion molecule that functions in the establishment and maintenance of epithelial cell morphology during embryongenesis and adulthood. The encoded preproprotein undergoes proteolytic processing to generate a mature protein. Targeted mutations disrupting binding of calcium to the encoded protein in mice cause death in utero due to failed blastocyst and trophectoderm formation. This gene is located adjacent to a related cadherin gene on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: In mutant homozygotes, adhesive cells of the morula dissociate shortly after initial compaction, probably due to depletion of maternal protein. Mutant embryos fail to form a trophectodermal epithelium or blastocyst cavity, and die near implantation time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 A T 10: 89,726,755 D87E probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Ano3 A T 2: 110,661,271 Y887N probably damaging Het
Arid4a A G 12: 71,060,093 D313G probably damaging Het
Armc2 A G 10: 42,011,927 V20A probably benign Het
C2 T A 17: 34,876,456 N171I possibly damaging Het
Cep89 T A 7: 35,417,645 V224E probably damaging Het
Dennd2d C T 3: 106,487,815 probably benign Het
Diaph1 T A 18: 37,853,355 K1157N probably damaging Het
Dsg4 T A 18: 20,462,492 L584* probably null Het
Exoc4 G A 6: 33,918,432 A795T probably benign Het
Fbln5 A T 12: 101,765,209 I242N probably damaging Het
Gls2 A G 10: 128,205,221 H394R probably damaging Het
Gm27013 C T 6: 130,675,958 C847Y possibly damaging Het
Ifna5 C A 4: 88,835,799 T92K possibly damaging Het
Ireb2 A G 9: 54,900,516 M674V probably benign Het
Itga2 C T 13: 114,839,570 V1089M possibly damaging Het
Kctd16 A T 18: 40,258,869 Y170F probably benign Het
Kif15 A G 9: 123,013,974 N45D possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mink1 A G 11: 70,606,075 K420E possibly damaging Het
Ms4a14 G T 19: 11,302,027 Q1056K probably benign Het
Olfr1053 T A 2: 86,314,398 E296V probably damaging Het
Olfr175-ps1 T C 16: 58,823,953 Y252C probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Ovch2 T C 7: 107,781,978 E571G probably benign Het
Pmel T C 10: 128,714,381 V95A probably damaging Het
Ptger2 G T 14: 44,989,142 G60C probably benign Het
Ranbp2 T G 10: 58,476,825 S1122R probably benign Het
Rasal2 T C 1: 157,176,162 D309G probably damaging Het
Rcc2 T A 4: 140,715,919 C303S probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpini1 C T 3: 75,613,081 probably benign Het
Sgo2a G T 1: 58,019,660 E1133* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smarcc1 G A 9: 110,132,183 probably benign Het
Tbcd A G 11: 121,592,692 E749G probably benign Het
Tmc3 G A 7: 83,599,982 A260T probably benign Het
Tnfrsf21 A G 17: 43,037,659 Y54C probably damaging Het
Uhrf1bp1l A G 10: 89,787,199 D312G possibly damaging Het
Urb1 T A 16: 90,776,163 M994L probably benign Het
Usp14 A T 18: 10,009,935 probably benign Het
Vps13a T C 19: 16,664,564 Y2233C probably damaging Het
Wdr66 G A 5: 123,298,521 V1038I probably benign Het
Wnt2 G T 6: 17,990,028 A290E probably damaging Het
Zc3h8 A T 2: 128,930,892 C225* probably null Het
Other mutations in Cdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Cdh1 APN 8 106660884 missense probably damaging 1.00
IGL01405:Cdh1 APN 8 106649001 missense probably damaging 0.97
IGL01410:Cdh1 APN 8 106657853 missense probably benign 0.19
IGL01901:Cdh1 APN 8 106657760 missense probably damaging 0.99
IGL02197:Cdh1 APN 8 106653786 missense probably benign 0.29
IGL02580:Cdh1 APN 8 106649018 missense probably benign 0.01
IGL02690:Cdh1 APN 8 106657884 missense probably damaging 1.00
IGL02732:Cdh1 APN 8 106666323 missense probably damaging 1.00
IGL02927:Cdh1 APN 8 106668511 missense probably damaging 1.00
R1777:Cdh1 UTSW 8 106656835 missense probably damaging 1.00
R1826:Cdh1 UTSW 8 106666266 missense probably benign 0.03
R1892:Cdh1 UTSW 8 106664250 missense possibly damaging 0.72
R2045:Cdh1 UTSW 8 106666182 splice site probably benign
R2100:Cdh1 UTSW 8 106659668 missense possibly damaging 0.57
R2104:Cdh1 UTSW 8 106653759 splice site probably benign
R2118:Cdh1 UTSW 8 106664210 missense probably benign
R2121:Cdh1 UTSW 8 106664210 missense probably benign
R2124:Cdh1 UTSW 8 106664210 missense probably benign
R2125:Cdh1 UTSW 8 106656840 missense probably damaging 0.99
R2163:Cdh1 UTSW 8 106649081 missense probably benign 0.01
R2165:Cdh1 UTSW 8 106664321 missense probably damaging 1.00
R2266:Cdh1 UTSW 8 106662003 missense probably benign
R2761:Cdh1 UTSW 8 106653849 missense possibly damaging 0.90
R4547:Cdh1 UTSW 8 106663903 missense probably damaging 1.00
R5131:Cdh1 UTSW 8 106663798 missense possibly damaging 0.95
R5931:Cdh1 UTSW 8 106666332 critical splice donor site probably null
R6254:Cdh1 UTSW 8 106663798 missense probably damaging 1.00
R6397:Cdh1 UTSW 8 106604290 missense possibly damaging 0.81
R6888:Cdh1 UTSW 8 106658314 missense probably benign 0.09
R6928:Cdh1 UTSW 8 106661010 missense possibly damaging 0.93
R6995:Cdh1 UTSW 8 106660913 missense probably benign 0.02
R7110:Cdh1 UTSW 8 106668544 missense possibly damaging 0.87
R8069:Cdh1 UTSW 8 106657773 missense probably benign 0.26
R8260:Cdh1 UTSW 8 106604347 missense probably benign 0.01
R8387:Cdh1 UTSW 8 106663869 missense probably benign 0.02
Z1177:Cdh1 UTSW 8 106656839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATACTGATAAGTACGGTGC -3'
(R):5'- TAACACAGACAGTCCAGTAGGG -3'

Sequencing Primer
(F):5'- GCATACTGATAAGTACGGTGCTCTTC -3'
(R):5'- GTGAGACCACTATGCAATCTGC -3'
Posted On2016-11-21