Incidental Mutation 'R5767:Ireb2'
ID446332
Institutional Source Beutler Lab
Gene Symbol Ireb2
Ensembl Gene ENSMUSG00000032293
Gene Nameiron responsive element binding protein 2
SynonymsD9Ertd85e, Irp2
MMRRC Submission 043367-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5767 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location54863789-54912530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54900516 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 674 (M674V)
Ref Sequence ENSEMBL: ENSMUSP00000034843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034843]
Predicted Effect probably benign
Transcript: ENSMUST00000034843
AA Change: M674V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034843
Gene: ENSMUSG00000032293
AA Change: M674V

DomainStartEndE-ValueType
Pfam:Aconitase 59 155 6.5e-16 PFAM
Pfam:Aconitase 186 639 2e-129 PFAM
Pfam:Aconitase_C 767 896 1.5e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213482
Predicted Effect unknown
Transcript: ENSMUST00000214023
AA Change: M154V
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in microcytic anemia, altered body iron homeostasis, and variable behavioral and neurological phenotypes that may include pathological signs of neurodegeneration or brain iron accumulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 A T 10: 89,726,755 D87E probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Ano3 A T 2: 110,661,271 Y887N probably damaging Het
Arid4a A G 12: 71,060,093 D313G probably damaging Het
Armc2 A G 10: 42,011,927 V20A probably benign Het
C2 T A 17: 34,876,456 N171I possibly damaging Het
Cdh1 C A 8: 106,668,555 N865K probably damaging Het
Cep89 T A 7: 35,417,645 V224E probably damaging Het
Dennd2d C T 3: 106,487,815 probably benign Het
Diaph1 T A 18: 37,853,355 K1157N probably damaging Het
Dsg4 T A 18: 20,462,492 L584* probably null Het
Exoc4 G A 6: 33,918,432 A795T probably benign Het
Fbln5 A T 12: 101,765,209 I242N probably damaging Het
Gls2 A G 10: 128,205,221 H394R probably damaging Het
Gm27013 C T 6: 130,675,958 C847Y possibly damaging Het
Ifna5 C A 4: 88,835,799 T92K possibly damaging Het
Itga2 C T 13: 114,839,570 V1089M possibly damaging Het
Kctd16 A T 18: 40,258,869 Y170F probably benign Het
Kif15 A G 9: 123,013,974 N45D possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mink1 A G 11: 70,606,075 K420E possibly damaging Het
Ms4a14 G T 19: 11,302,027 Q1056K probably benign Het
Olfr1053 T A 2: 86,314,398 E296V probably damaging Het
Olfr175-ps1 T C 16: 58,823,953 Y252C probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Ovch2 T C 7: 107,781,978 E571G probably benign Het
Pmel T C 10: 128,714,381 V95A probably damaging Het
Ptger2 G T 14: 44,989,142 G60C probably benign Het
Ranbp2 T G 10: 58,476,825 S1122R probably benign Het
Rasal2 T C 1: 157,176,162 D309G probably damaging Het
Rcc2 T A 4: 140,715,919 C303S probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpini1 C T 3: 75,613,081 probably benign Het
Sgo2a G T 1: 58,019,660 E1133* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smarcc1 G A 9: 110,132,183 probably benign Het
Tbcd A G 11: 121,592,692 E749G probably benign Het
Tmc3 G A 7: 83,599,982 A260T probably benign Het
Tnfrsf21 A G 17: 43,037,659 Y54C probably damaging Het
Uhrf1bp1l A G 10: 89,787,199 D312G possibly damaging Het
Urb1 T A 16: 90,776,163 M994L probably benign Het
Usp14 A T 18: 10,009,935 probably benign Het
Vps13a T C 19: 16,664,564 Y2233C probably damaging Het
Wdr66 G A 5: 123,298,521 V1038I probably benign Het
Wnt2 G T 6: 17,990,028 A290E probably damaging Het
Zc3h8 A T 2: 128,930,892 C225* probably null Het
Other mutations in Ireb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Ireb2 APN 9 54899482 splice site probably benign
IGL01576:Ireb2 APN 9 54892510 missense probably damaging 1.00
IGL01844:Ireb2 APN 9 54865357 missense probably benign 0.01
tony_stark UTSW 9 54903961 missense probably damaging 1.00
R0143:Ireb2 UTSW 9 54885909 missense probably benign 0.06
R0279:Ireb2 UTSW 9 54886593 missense probably benign
R0400:Ireb2 UTSW 9 54896498 missense probably benign
R0565:Ireb2 UTSW 9 54899983 missense probably damaging 1.00
R0686:Ireb2 UTSW 9 54904176 missense probably benign 0.44
R0706:Ireb2 UTSW 9 54892486 missense probably benign
R0894:Ireb2 UTSW 9 54896577 missense probably damaging 1.00
R1101:Ireb2 UTSW 9 54909702 missense probably benign 0.35
R1680:Ireb2 UTSW 9 54881518 missense probably damaging 1.00
R2074:Ireb2 UTSW 9 54881449 missense probably benign
R2080:Ireb2 UTSW 9 54896552 missense possibly damaging 0.85
R2891:Ireb2 UTSW 9 54899990 missense probably benign 0.01
R3153:Ireb2 UTSW 9 54885946 critical splice donor site probably null
R3154:Ireb2 UTSW 9 54885946 critical splice donor site probably null
R3844:Ireb2 UTSW 9 54892505 missense probably damaging 0.99
R4128:Ireb2 UTSW 9 54881432 missense probably benign 0.32
R4803:Ireb2 UTSW 9 54906814 missense probably benign 0.01
R5097:Ireb2 UTSW 9 54895384 missense probably benign 0.04
R5159:Ireb2 UTSW 9 54892547 missense probably benign
R5227:Ireb2 UTSW 9 54896601 critical splice donor site probably null
R6005:Ireb2 UTSW 9 54908805 missense probably damaging 1.00
R6127:Ireb2 UTSW 9 54882368 missense probably benign
R6155:Ireb2 UTSW 9 54886527 missense probably damaging 1.00
R6170:Ireb2 UTSW 9 54887372 missense probably benign 0.00
R6341:Ireb2 UTSW 9 54908780 missense probably damaging 0.99
R6707:Ireb2 UTSW 9 54903961 missense probably damaging 1.00
R6973:Ireb2 UTSW 9 54882387 missense probably benign 0.00
R7108:Ireb2 UTSW 9 54906641 missense probably damaging 1.00
R7126:Ireb2 UTSW 9 54886567 nonsense probably null
R7314:Ireb2 UTSW 9 54892510 missense probably damaging 1.00
R7396:Ireb2 UTSW 9 54882333 missense possibly damaging 0.83
R7472:Ireb2 UTSW 9 54884054 missense probably benign 0.11
R7590:Ireb2 UTSW 9 54896495 missense probably benign 0.00
RF006:Ireb2 UTSW 9 54881484 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CACACCCCATTGTTAAATCAGTTAC -3'
(R):5'- TGTCATCAAGAACACCTCCG -3'

Sequencing Primer
(F):5'- CAGTTACTTGATTTCTGTGACTTTTC -3'
(R):5'- GCTATGTGAGACCTTGCTT -3'
Posted On2016-11-21