Incidental Mutation 'R5767:Armc2'
ID446335
Institutional Source Beutler Lab
Gene Symbol Armc2
Ensembl Gene ENSMUSG00000071324
Gene Namearmadillo repeat containing 2
Synonyms
MMRRC Submission 043367-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5767 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location41914990-42018442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42011927 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 20 (V20A)
Ref Sequence ENSEMBL: ENSMUSP00000125583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095729] [ENSMUST00000160262] [ENSMUST00000161081] [ENSMUST00000161927] [ENSMUST00000162405]
Predicted Effect probably benign
Transcript: ENSMUST00000095729
AA Change: V20A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093397
Gene: ENSMUSG00000071324
AA Change: V20A

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 222 237 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 324 336 N/A INTRINSIC
ARM 355 393 7.53e1 SMART
ARM 400 453 3.69e1 SMART
ARM 454 496 8.23e1 SMART
Blast:ARM 497 540 1e-16 BLAST
Blast:ARM 542 603 1e-6 BLAST
Blast:ARM 603 649 7e-20 BLAST
Blast:ARM 653 692 3e-8 BLAST
ARM 693 733 4.41e1 SMART
ARM 734 777 2.7e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160262
AA Change: V20A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125412
Gene: ENSMUSG00000071324
AA Change: V20A

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 222 237 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 324 336 N/A INTRINSIC
ARM 355 393 7.53e1 SMART
ARM 400 453 3.69e1 SMART
ARM 454 496 8.23e1 SMART
Blast:ARM 497 540 1e-16 BLAST
Blast:ARM 542 603 1e-6 BLAST
Blast:ARM 603 649 7e-20 BLAST
Blast:ARM 653 692 3e-8 BLAST
ARM 693 733 4.41e1 SMART
ARM 734 777 2.7e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161081
AA Change: V20A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125719
Gene: ENSMUSG00000071324
AA Change: V20A

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161927
AA Change: V20A

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124049
Gene: ENSMUSG00000071324
AA Change: V20A

DomainStartEndE-ValueType
low complexity region 58 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162405
AA Change: V20A

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125583
Gene: ENSMUSG00000071324
AA Change: V20A

DomainStartEndE-ValueType
low complexity region 58 75 N/A INTRINSIC
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 A T 10: 89,726,755 D87E probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Ano3 A T 2: 110,661,271 Y887N probably damaging Het
Arid4a A G 12: 71,060,093 D313G probably damaging Het
C2 T A 17: 34,876,456 N171I possibly damaging Het
Cdh1 C A 8: 106,668,555 N865K probably damaging Het
Cep89 T A 7: 35,417,645 V224E probably damaging Het
Dennd2d C T 3: 106,487,815 probably benign Het
Diaph1 T A 18: 37,853,355 K1157N probably damaging Het
Dsg4 T A 18: 20,462,492 L584* probably null Het
Exoc4 G A 6: 33,918,432 A795T probably benign Het
Fbln5 A T 12: 101,765,209 I242N probably damaging Het
Gls2 A G 10: 128,205,221 H394R probably damaging Het
Gm27013 C T 6: 130,675,958 C847Y possibly damaging Het
Ifna5 C A 4: 88,835,799 T92K possibly damaging Het
Ireb2 A G 9: 54,900,516 M674V probably benign Het
Itga2 C T 13: 114,839,570 V1089M possibly damaging Het
Kctd16 A T 18: 40,258,869 Y170F probably benign Het
Kif15 A G 9: 123,013,974 N45D possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mink1 A G 11: 70,606,075 K420E possibly damaging Het
Ms4a14 G T 19: 11,302,027 Q1056K probably benign Het
Olfr1053 T A 2: 86,314,398 E296V probably damaging Het
Olfr175-ps1 T C 16: 58,823,953 Y252C probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Ovch2 T C 7: 107,781,978 E571G probably benign Het
Pmel T C 10: 128,714,381 V95A probably damaging Het
Ptger2 G T 14: 44,989,142 G60C probably benign Het
Ranbp2 T G 10: 58,476,825 S1122R probably benign Het
Rasal2 T C 1: 157,176,162 D309G probably damaging Het
Rcc2 T A 4: 140,715,919 C303S probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpini1 C T 3: 75,613,081 probably benign Het
Sgo2a G T 1: 58,019,660 E1133* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smarcc1 G A 9: 110,132,183 probably benign Het
Tbcd A G 11: 121,592,692 E749G probably benign Het
Tmc3 G A 7: 83,599,982 A260T probably benign Het
Tnfrsf21 A G 17: 43,037,659 Y54C probably damaging Het
Uhrf1bp1l A G 10: 89,787,199 D312G possibly damaging Het
Urb1 T A 16: 90,776,163 M994L probably benign Het
Usp14 A T 18: 10,009,935 probably benign Het
Vps13a T C 19: 16,664,564 Y2233C probably damaging Het
Wdr66 G A 5: 123,298,521 V1038I probably benign Het
Wnt2 G T 6: 17,990,028 A290E probably damaging Het
Zc3h8 A T 2: 128,930,892 C225* probably null Het
Other mutations in Armc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4131001:Armc2 UTSW 10 41947887 splice site probably benign
R0144:Armc2 UTSW 10 41947887 splice site probably benign
R0427:Armc2 UTSW 10 42000410 missense possibly damaging 0.87
R0540:Armc2 UTSW 10 41922695 missense probably benign 0.11
R0561:Armc2 UTSW 10 41993192 missense probably benign 0.02
R0607:Armc2 UTSW 10 41922695 missense probably benign 0.11
R1099:Armc2 UTSW 10 41917187 missense probably benign 0.39
R1130:Armc2 UTSW 10 42011834 missense possibly damaging 0.85
R2116:Armc2 UTSW 10 41963667 missense probably damaging 0.98
R2870:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2870:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2871:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2871:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2872:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2872:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2873:Armc2 UTSW 10 41966700 critical splice donor site probably null
R3083:Armc2 UTSW 10 41966730 missense probably damaging 1.00
R3771:Armc2 UTSW 10 41922227 missense probably damaging 1.00
R3784:Armc2 UTSW 10 41922194 missense probably benign 0.08
R3880:Armc2 UTSW 10 41963725 missense possibly damaging 0.71
R4024:Armc2 UTSW 10 41993058 missense probably benign
R4155:Armc2 UTSW 10 42011867 missense probably damaging 0.96
R4370:Armc2 UTSW 10 41917200 missense probably benign 0.13
R4378:Armc2 UTSW 10 41993082 missense possibly damaging 0.66
R4896:Armc2 UTSW 10 41923794 missense probably damaging 1.00
R5119:Armc2 UTSW 10 41922148 missense probably damaging 1.00
R5159:Armc2 UTSW 10 42008715 missense probably damaging 0.96
R5517:Armc2 UTSW 10 41963850 missense probably benign 0.29
R5640:Armc2 UTSW 10 42011898 missense possibly damaging 0.87
R5965:Armc2 UTSW 10 41922572 missense possibly damaging 0.94
R6897:Armc2 UTSW 10 41993229 critical splice acceptor site probably null
R7233:Armc2 UTSW 10 41923804 missense probably damaging 1.00
R7829:Armc2 UTSW 10 41926860 missense probably benign
R7832:Armc2 UTSW 10 41966796 missense probably damaging 1.00
R7999:Armc2 UTSW 10 42011958 missense possibly damaging 0.62
R8029:Armc2 UTSW 10 41927000 missense probably damaging 1.00
R8030:Armc2 UTSW 10 41966742 missense possibly damaging 0.73
R8033:Armc2 UTSW 10 42008684 missense possibly damaging 0.87
R8191:Armc2 UTSW 10 41963751 missense probably benign 0.29
R8304:Armc2 UTSW 10 41947939 missense probably damaging 1.00
R8334:Armc2 UTSW 10 41923765 missense probably damaging 1.00
R8370:Armc2 UTSW 10 41923837 missense possibly damaging 0.96
Z1176:Armc2 UTSW 10 41927044 missense probably damaging 1.00
Z1176:Armc2 UTSW 10 41963656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAACATGTAACCTGGTGG -3'
(R):5'- TCCTCCTGGCTGTATGTATAGAG -3'

Sequencing Primer
(F):5'- TGTAGACCACAGCCAGGC -3'
(R):5'- CCTGGCTGTATGTATAGAGTAGTAGC -3'
Posted On2016-11-21