Incidental Mutation 'R5767:Uhrf1bp1l'
ID446338
Institutional Source Beutler Lab
Gene Symbol Uhrf1bp1l
Ensembl Gene ENSMUSG00000019951
Gene NameUHRF1 (ICBP90) binding protein 1-like
Synonyms4930506D01Rik, E030041M21Rik, 2010319N22Rik
MMRRC Submission 043367-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R5767 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location89744991-89819871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89787199 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 312 (D312G)
Ref Sequence ENSEMBL: ENSMUSP00000020112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020112] [ENSMUST00000219712] [ENSMUST00000220375]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020112
AA Change: D312G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020112
Gene: ENSMUSG00000019951
AA Change: D312G

DomainStartEndE-ValueType
Pfam:Chorein_N 1 103 9.3e-21 PFAM
SCOP:d1c52__ 243 304 5e-3 SMART
low complexity region 788 801 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
coiled coil region 1410 1455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218776
Predicted Effect probably benign
Transcript: ENSMUST00000219712
Predicted Effect probably benign
Transcript: ENSMUST00000220375
AA Change: D224G

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1543 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 A T 10: 89,726,755 D87E probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Ano3 A T 2: 110,661,271 Y887N probably damaging Het
Arid4a A G 12: 71,060,093 D313G probably damaging Het
Armc2 A G 10: 42,011,927 V20A probably benign Het
C2 T A 17: 34,876,456 N171I possibly damaging Het
Cdh1 C A 8: 106,668,555 N865K probably damaging Het
Cep89 T A 7: 35,417,645 V224E probably damaging Het
Dennd2d C T 3: 106,487,815 probably benign Het
Diaph1 T A 18: 37,853,355 K1157N probably damaging Het
Dsg4 T A 18: 20,462,492 L584* probably null Het
Exoc4 G A 6: 33,918,432 A795T probably benign Het
Fbln5 A T 12: 101,765,209 I242N probably damaging Het
Gls2 A G 10: 128,205,221 H394R probably damaging Het
Gm27013 C T 6: 130,675,958 C847Y possibly damaging Het
Ifna5 C A 4: 88,835,799 T92K possibly damaging Het
Ireb2 A G 9: 54,900,516 M674V probably benign Het
Itga2 C T 13: 114,839,570 V1089M possibly damaging Het
Kctd16 A T 18: 40,258,869 Y170F probably benign Het
Kif15 A G 9: 123,013,974 N45D possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mink1 A G 11: 70,606,075 K420E possibly damaging Het
Ms4a14 G T 19: 11,302,027 Q1056K probably benign Het
Olfr1053 T A 2: 86,314,398 E296V probably damaging Het
Olfr175-ps1 T C 16: 58,823,953 Y252C probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Ovch2 T C 7: 107,781,978 E571G probably benign Het
Pmel T C 10: 128,714,381 V95A probably damaging Het
Ptger2 G T 14: 44,989,142 G60C probably benign Het
Ranbp2 T G 10: 58,476,825 S1122R probably benign Het
Rasal2 T C 1: 157,176,162 D309G probably damaging Het
Rcc2 T A 4: 140,715,919 C303S probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpini1 C T 3: 75,613,081 probably benign Het
Sgo2a G T 1: 58,019,660 E1133* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smarcc1 G A 9: 110,132,183 probably benign Het
Tbcd A G 11: 121,592,692 E749G probably benign Het
Tmc3 G A 7: 83,599,982 A260T probably benign Het
Tnfrsf21 A G 17: 43,037,659 Y54C probably damaging Het
Urb1 T A 16: 90,776,163 M994L probably benign Het
Usp14 A T 18: 10,009,935 probably benign Het
Vps13a T C 19: 16,664,564 Y2233C probably damaging Het
Wdr66 G A 5: 123,298,521 V1038I probably benign Het
Wnt2 G T 6: 17,990,028 A290E probably damaging Het
Zc3h8 A T 2: 128,930,892 C225* probably null Het
Other mutations in Uhrf1bp1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Uhrf1bp1l APN 10 89779984 missense probably damaging 1.00
IGL01102:Uhrf1bp1l APN 10 89791378 missense probably benign 0.00
IGL01457:Uhrf1bp1l APN 10 89805762 missense probably benign 0.06
IGL01647:Uhrf1bp1l APN 10 89774120 critical splice donor site probably null
IGL02552:Uhrf1bp1l APN 10 89806743 nonsense probably null
IGL02686:Uhrf1bp1l APN 10 89805193 missense probably benign
miscreant UTSW 10 89779963 missense probably damaging 0.97
scofflaw UTSW 10 89805684 missense probably benign 0.01
R0019:Uhrf1bp1l UTSW 10 89775969 missense probably damaging 1.00
R0505:Uhrf1bp1l UTSW 10 89791443 missense probably damaging 1.00
R0746:Uhrf1bp1l UTSW 10 89805454 missense probably benign 0.37
R1255:Uhrf1bp1l UTSW 10 89745270 missense probably damaging 0.98
R1385:Uhrf1bp1l UTSW 10 89790641 missense possibly damaging 0.92
R1720:Uhrf1bp1l UTSW 10 89782586 missense probably damaging 1.00
R2142:Uhrf1bp1l UTSW 10 89812048 missense probably damaging 1.00
R2312:Uhrf1bp1l UTSW 10 89781133 missense probably damaging 0.99
R2986:Uhrf1bp1l UTSW 10 89806069 missense probably benign 0.00
R4063:Uhrf1bp1l UTSW 10 89816055 missense probably benign 0.38
R4278:Uhrf1bp1l UTSW 10 89806709 splice site probably null
R4854:Uhrf1bp1l UTSW 10 89794484 missense probably damaging 1.00
R4857:Uhrf1bp1l UTSW 10 89779963 missense probably damaging 0.97
R5135:Uhrf1bp1l UTSW 10 89789355 missense probably damaging 1.00
R5467:Uhrf1bp1l UTSW 10 89805099 missense probably damaging 1.00
R5567:Uhrf1bp1l UTSW 10 89808521 missense probably benign 0.18
R6191:Uhrf1bp1l UTSW 10 89805318 missense possibly damaging 0.78
R6196:Uhrf1bp1l UTSW 10 89805333 missense probably benign 0.00
R6387:Uhrf1bp1l UTSW 10 89803057 nonsense probably null
R6729:Uhrf1bp1l UTSW 10 89805684 missense probably benign 0.01
R6746:Uhrf1bp1l UTSW 10 89787158 missense probably benign 0.19
R6794:Uhrf1bp1l UTSW 10 89805762 missense probably benign 0.06
R6892:Uhrf1bp1l UTSW 10 89805123 missense probably benign 0.02
R6990:Uhrf1bp1l UTSW 10 89806117 missense probably benign 0.12
R7188:Uhrf1bp1l UTSW 10 89779882 missense probably damaging 0.96
R7226:Uhrf1bp1l UTSW 10 89808641 missense probably benign 0.00
R7376:Uhrf1bp1l UTSW 10 89809656 missense probably damaging 1.00
R7836:Uhrf1bp1l UTSW 10 89816106 missense probably benign 0.00
R8188:Uhrf1bp1l UTSW 10 89812066 missense possibly damaging 0.50
R8343:Uhrf1bp1l UTSW 10 89791419 missense probably benign
R8356:Uhrf1bp1l UTSW 10 89812092 missense probably benign 0.00
R8367:Uhrf1bp1l UTSW 10 89805377 missense probably damaging 1.00
R8391:Uhrf1bp1l UTSW 10 89809743 missense possibly damaging 0.58
R8456:Uhrf1bp1l UTSW 10 89812092 missense probably benign 0.00
R8546:Uhrf1bp1l UTSW 10 89794535 missense probably damaging 1.00
R8728:Uhrf1bp1l UTSW 10 89782720 missense probably benign 0.00
R8816:Uhrf1bp1l UTSW 10 89790735 critical splice donor site probably benign
X0060:Uhrf1bp1l UTSW 10 89805379 missense probably damaging 0.98
Z1177:Uhrf1bp1l UTSW 10 89812072 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGCTGGAAACATGCAGGTTTG -3'
(R):5'- CTAATTTTACTGTTAGCATTGATAGCC -3'

Sequencing Primer
(F):5'- GCTTGTCTGTGACACTCTGAG -3'
(R):5'- CAGCCATCTGTAATGAGATCTGCTG -3'
Posted On2016-11-21