Incidental Mutation 'R5767:Gls2'
ID446339
Institutional Source Beutler Lab
Gene Symbol Gls2
Ensembl Gene ENSMUSG00000044005
Gene Nameglutaminase 2 (liver, mitochondrial)
SynonymsLga, A330074B06Rik
MMRRC Submission 043367-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5767 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128194457-128210004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128205221 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 394 (H394R)
Ref Sequence ENSEMBL: ENSMUSP00000047376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044776] [ENSMUST00000061995] [ENSMUST00000143827] [ENSMUST00000159440]
Predicted Effect probably damaging
Transcript: ENSMUST00000044776
AA Change: H394R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047376
Gene: ENSMUSG00000044005
AA Change: H394R

DomainStartEndE-ValueType
Pfam:Glutaminase 177 463 1.1e-116 PFAM
ANK 518 548 3.76e-5 SMART
ANK 552 581 1.21e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061995
SMART Domains Protein: ENSMUSP00000054731
Gene: ENSMUSG00000051346

DomainStartEndE-ValueType
Blast:PRY 29 84 2e-26 BLAST
Pfam:SPRY 87 199 1.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132441
SMART Domains Protein: ENSMUSP00000115788
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
Pfam:Glutaminase 1 37 7.9e-9 PFAM
ANK 92 122 3.76e-5 SMART
ANK 126 155 1.21e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134104
SMART Domains Protein: ENSMUSP00000123436
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
PDB:4JKT|D 60 172 1e-48 PDB
low complexity region 191 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135441
Predicted Effect probably benign
Transcript: ENSMUST00000143827
SMART Domains Protein: ENSMUSP00000119763
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
PDB:4JKT|D 67 135 5e-25 PDB
low complexity region 170 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145591
Predicted Effect probably benign
Transcript: ENSMUST00000159440
SMART Domains Protein: ENSMUSP00000124239
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
PDB:4JKT|D 67 134 9e-25 PDB
Meta Mutation Damage Score 0.7095 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitochondrial phosphate-activated glutaminase that catalyzes the hydrolysis of glutamine to stoichiometric amounts of glutamate and ammonia. Originally thought to be liver-specific, this protein has been found in other tissues as well. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 A T 10: 89,726,755 D87E probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Ano3 A T 2: 110,661,271 Y887N probably damaging Het
Arid4a A G 12: 71,060,093 D313G probably damaging Het
Armc2 A G 10: 42,011,927 V20A probably benign Het
C2 T A 17: 34,876,456 N171I possibly damaging Het
Cdh1 C A 8: 106,668,555 N865K probably damaging Het
Cep89 T A 7: 35,417,645 V224E probably damaging Het
Dennd2d C T 3: 106,487,815 probably benign Het
Diaph1 T A 18: 37,853,355 K1157N probably damaging Het
Dsg4 T A 18: 20,462,492 L584* probably null Het
Exoc4 G A 6: 33,918,432 A795T probably benign Het
Fbln5 A T 12: 101,765,209 I242N probably damaging Het
Gm27013 C T 6: 130,675,958 C847Y possibly damaging Het
Ifna5 C A 4: 88,835,799 T92K possibly damaging Het
Ireb2 A G 9: 54,900,516 M674V probably benign Het
Itga2 C T 13: 114,839,570 V1089M possibly damaging Het
Kctd16 A T 18: 40,258,869 Y170F probably benign Het
Kif15 A G 9: 123,013,974 N45D possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mink1 A G 11: 70,606,075 K420E possibly damaging Het
Ms4a14 G T 19: 11,302,027 Q1056K probably benign Het
Olfr1053 T A 2: 86,314,398 E296V probably damaging Het
Olfr175-ps1 T C 16: 58,823,953 Y252C probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Ovch2 T C 7: 107,781,978 E571G probably benign Het
Pmel T C 10: 128,714,381 V95A probably damaging Het
Ptger2 G T 14: 44,989,142 G60C probably benign Het
Ranbp2 T G 10: 58,476,825 S1122R probably benign Het
Rasal2 T C 1: 157,176,162 D309G probably damaging Het
Rcc2 T A 4: 140,715,919 C303S probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpini1 C T 3: 75,613,081 probably benign Het
Sgo2a G T 1: 58,019,660 E1133* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smarcc1 G A 9: 110,132,183 probably benign Het
Tbcd A G 11: 121,592,692 E749G probably benign Het
Tmc3 G A 7: 83,599,982 A260T probably benign Het
Tnfrsf21 A G 17: 43,037,659 Y54C probably damaging Het
Uhrf1bp1l A G 10: 89,787,199 D312G possibly damaging Het
Urb1 T A 16: 90,776,163 M994L probably benign Het
Usp14 A T 18: 10,009,935 probably benign Het
Vps13a T C 19: 16,664,564 Y2233C probably damaging Het
Wdr66 G A 5: 123,298,521 V1038I probably benign Het
Wnt2 G T 6: 17,990,028 A290E probably damaging Het
Zc3h8 A T 2: 128,930,892 C225* probably null Het
Other mutations in Gls2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Gls2 APN 10 128200971 splice site probably null
IGL00583:Gls2 APN 10 128204882 missense probably benign 0.11
IGL01444:Gls2 APN 10 128201347 missense probably damaging 1.00
IGL02746:Gls2 APN 10 128200956 missense probably damaging 1.00
R0015:Gls2 UTSW 10 128209350 missense probably damaging 1.00
R0024:Gls2 UTSW 10 128199256 missense probably damaging 1.00
R0378:Gls2 UTSW 10 128207311 missense probably benign
R1179:Gls2 UTSW 10 128199234 missense probably damaging 1.00
R1227:Gls2 UTSW 10 128199664 missense probably damaging 1.00
R1421:Gls2 UTSW 10 128201348 nonsense probably null
R1750:Gls2 UTSW 10 128201325 missense probably damaging 1.00
R1952:Gls2 UTSW 10 128209362 missense probably benign
R2218:Gls2 UTSW 10 128204714 missense probably damaging 1.00
R2291:Gls2 UTSW 10 128207610 nonsense probably null
R2382:Gls2 UTSW 10 128203842 missense probably damaging 1.00
R4536:Gls2 UTSW 10 128200937 missense probably benign 0.00
R5305:Gls2 UTSW 10 128204709 nonsense probably null
R5435:Gls2 UTSW 10 128195126 intron probably benign
R7223:Gls2 UTSW 10 128199194 missense probably benign
R7767:Gls2 UTSW 10 128195129 missense unknown
R8068:Gls2 UTSW 10 128195114 missense unknown
R8084:Gls2 UTSW 10 128199256 missense probably damaging 1.00
R8329:Gls2 UTSW 10 128201285 missense probably benign 0.00
R8872:Gls2 UTSW 10 128204666 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCCTCCTGTTAAACGGTAG -3'
(R):5'- GCATCTAAGATGGGAGCCAG -3'

Sequencing Primer
(F):5'- TAATGTGTTCGAGTCTACACTGC -3'
(R):5'- CTTAGCCTATTTGCCTGG -3'
Posted On2016-11-21