Incidental Mutation 'R5767:Tbcd'
ID446342
Institutional Source Beutler Lab
Gene Symbol Tbcd
Ensembl Gene ENSMUSG00000039230
Gene Nametubulin-specific chaperone d
Synonyms2310057L06Rik, A030005L14Rik
MMRRC Submission 043367-MU
Accession Numbers

Ncbi RefSeq: NM_029878.3; MGI:1919686

Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R5767 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location121451949-121617164 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121592692 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 749 (E749G)
Ref Sequence ENSEMBL: ENSMUSP00000099302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103013]
Predicted Effect probably benign
Transcript: ENSMUST00000103013
AA Change: E749G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099302
Gene: ENSMUSG00000039230
AA Change: E749G

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 45 62 N/A INTRINSIC
SCOP:d1b3ua_ 357 742 4e-20 SMART
Pfam:TFCD_C 900 1090 1.4e-74 PFAM
low complexity region 1113 1120 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147560
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cofactor D is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 A T 10: 89,726,755 D87E probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Ano3 A T 2: 110,661,271 Y887N probably damaging Het
Arid4a A G 12: 71,060,093 D313G probably damaging Het
Armc2 A G 10: 42,011,927 V20A probably benign Het
C2 T A 17: 34,876,456 N171I possibly damaging Het
Cdh1 C A 8: 106,668,555 N865K probably damaging Het
Cep89 T A 7: 35,417,645 V224E probably damaging Het
Dennd2d C T 3: 106,487,815 probably benign Het
Diaph1 T A 18: 37,853,355 K1157N probably damaging Het
Dsg4 T A 18: 20,462,492 L584* probably null Het
Exoc4 G A 6: 33,918,432 A795T probably benign Het
Fbln5 A T 12: 101,765,209 I242N probably damaging Het
Gls2 A G 10: 128,205,221 H394R probably damaging Het
Gm27013 C T 6: 130,675,958 C847Y possibly damaging Het
Ifna5 C A 4: 88,835,799 T92K possibly damaging Het
Ireb2 A G 9: 54,900,516 M674V probably benign Het
Itga2 C T 13: 114,839,570 V1089M possibly damaging Het
Kctd16 A T 18: 40,258,869 Y170F probably benign Het
Kif15 A G 9: 123,013,974 N45D possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mink1 A G 11: 70,606,075 K420E possibly damaging Het
Ms4a14 G T 19: 11,302,027 Q1056K probably benign Het
Olfr1053 T A 2: 86,314,398 E296V probably damaging Het
Olfr175-ps1 T C 16: 58,823,953 Y252C probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Ovch2 T C 7: 107,781,978 E571G probably benign Het
Pmel T C 10: 128,714,381 V95A probably damaging Het
Ptger2 G T 14: 44,989,142 G60C probably benign Het
Ranbp2 T G 10: 58,476,825 S1122R probably benign Het
Rasal2 T C 1: 157,176,162 D309G probably damaging Het
Rcc2 T A 4: 140,715,919 C303S probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpini1 C T 3: 75,613,081 probably benign Het
Sgo2a G T 1: 58,019,660 E1133* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smarcc1 G A 9: 110,132,183 probably benign Het
Tmc3 G A 7: 83,599,982 A260T probably benign Het
Tnfrsf21 A G 17: 43,037,659 Y54C probably damaging Het
Uhrf1bp1l A G 10: 89,787,199 D312G possibly damaging Het
Urb1 T A 16: 90,776,163 M994L probably benign Het
Usp14 A T 18: 10,009,935 probably benign Het
Vps13a T C 19: 16,664,564 Y2233C probably damaging Het
Wdr66 G A 5: 123,298,521 V1038I probably benign Het
Wnt2 G T 6: 17,990,028 A290E probably damaging Het
Zc3h8 A T 2: 128,930,892 C225* probably null Het
Other mutations in Tbcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Tbcd APN 11 121575321 missense probably damaging 0.96
IGL00795:Tbcd APN 11 121616932 missense probably benign
IGL00802:Tbcd APN 11 121608610 missense possibly damaging 0.55
IGL01286:Tbcd APN 11 121493893 critical splice donor site probably null
IGL01325:Tbcd APN 11 121540993 missense probably damaging 0.99
IGL01348:Tbcd APN 11 121497076 missense probably benign
IGL01432:Tbcd APN 11 121475680 splice site probably benign
IGL01577:Tbcd APN 11 121497012 missense probably damaging 1.00
IGL01660:Tbcd APN 11 121605327 missense probably benign 0.01
IGL01865:Tbcd APN 11 121590380 missense possibly damaging 0.81
IGL02260:Tbcd APN 11 121603278 missense probably damaging 1.00
IGL02492:Tbcd APN 11 121497134 missense probably benign 0.06
IGL02620:Tbcd APN 11 121461255 missense probably damaging 1.00
IGL02950:Tbcd APN 11 121603709 missense probably damaging 0.99
R6859_Tbcd_818 UTSW 11 121497111 missense possibly damaging 0.81
R0066:Tbcd UTSW 11 121503764 nonsense probably null
R0066:Tbcd UTSW 11 121503764 nonsense probably null
R0077:Tbcd UTSW 11 121594274 missense probably benign 0.00
R0349:Tbcd UTSW 11 121602983 splice site probably null
R0865:Tbcd UTSW 11 121602989 missense possibly damaging 0.88
R1203:Tbcd UTSW 11 121475625 missense probably benign 0.00
R1221:Tbcd UTSW 11 121497083 missense probably benign 0.00
R1549:Tbcd UTSW 11 121560753 missense probably benign
R1586:Tbcd UTSW 11 121497060 missense probably benign 0.13
R1671:Tbcd UTSW 11 121597294 missense probably benign 0.00
R2048:Tbcd UTSW 11 121540936 missense probably damaging 1.00
R2051:Tbcd UTSW 11 121453670 missense probably damaging 1.00
R2124:Tbcd UTSW 11 121603320 missense probably damaging 1.00
R2151:Tbcd UTSW 11 121603631 missense possibly damaging 0.95
R2153:Tbcd UTSW 11 121603631 missense possibly damaging 0.95
R3120:Tbcd UTSW 11 121608648 missense probably damaging 0.97
R4108:Tbcd UTSW 11 121493811 missense probably benign 0.00
R4244:Tbcd UTSW 11 121594281 missense probably damaging 1.00
R4587:Tbcd UTSW 11 121605271 missense possibly damaging 0.75
R4684:Tbcd UTSW 11 121493771 missense probably damaging 1.00
R4837:Tbcd UTSW 11 121582785 critical splice donor site probably null
R4861:Tbcd UTSW 11 121601961 missense probably damaging 1.00
R4861:Tbcd UTSW 11 121601961 missense probably damaging 1.00
R4960:Tbcd UTSW 11 121573855 missense probably benign 0.03
R5157:Tbcd UTSW 11 121610027 missense probably benign 0.14
R5166:Tbcd UTSW 11 121609390 missense possibly damaging 0.87
R5403:Tbcd UTSW 11 121560743 missense probably damaging 0.99
R5406:Tbcd UTSW 11 121452101 missense probably benign
R5509:Tbcd UTSW 11 121602012 missense probably benign 0.00
R5923:Tbcd UTSW 11 121580152 missense probably benign
R5966:Tbcd UTSW 11 121601911 intron probably benign
R6330:Tbcd UTSW 11 121497086 missense probably benign
R6539:Tbcd UTSW 11 121556987 critical splice donor site probably null
R6852:Tbcd UTSW 11 121609380 missense probably benign 0.36
R6859:Tbcd UTSW 11 121497111 missense possibly damaging 0.81
R7348:Tbcd UTSW 11 121594311 missense probably benign 0.22
R7479:Tbcd UTSW 11 121492605 critical splice donor site probably null
R7679:Tbcd UTSW 11 121603708 missense probably benign 0.01
R8121:Tbcd UTSW 11 121597143 splice site probably null
R8163:Tbcd UTSW 11 121493885 missense probably benign 0.00
R8165:Tbcd UTSW 11 121493885 missense probably benign 0.00
R8172:Tbcd UTSW 11 121493885 missense probably benign 0.00
Z1177:Tbcd UTSW 11 121590406 missense probably null 0.14
Predicted Primers PCR Primer
(F):5'- GCCAGAGTGTAACAATGACATAC -3'
(R):5'- TGTAACAGAGACCTCCCTCC -3'

Sequencing Primer
(F):5'- TATTGCAGAGACCCAGTC -3'
(R):5'- TGTAGCCTAGTCGCCTGG -3'
Posted On2016-11-21