Incidental Mutation 'R5767:Olfr738'
ID446347
Institutional Source Beutler Lab
Gene Symbol Olfr738
Ensembl Gene ENSMUSG00000094692
Gene Nameolfactory receptor 738
SynonymsGA_x6K02T2PMLR-6110726-6111661, MOR106-3
MMRRC Submission 043367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5767 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50407568-50415438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50413778 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 78 (V78A)
Ref Sequence ENSEMBL: ENSMUSP00000150351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058972] [ENSMUST00000214320] [ENSMUST00000214853] [ENSMUST00000216949]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058972
AA Change: V78A

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000059540
Gene: ENSMUSG00000094692
AA Change: V78A

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.5e-50 PFAM
Pfam:7TM_GPCR_Srsx 39 309 1.3e-5 PFAM
Pfam:7tm_1 45 294 6.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205382
Predicted Effect possibly damaging
Transcript: ENSMUST00000214320
AA Change: V78A

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214853
AA Change: V78A

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000216949
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 A T 10: 89,726,755 D87E probably damaging Het
AI429214 TCCCTGATGAAC TC 8: 36,994,229 probably null Het
Ano3 A T 2: 110,661,271 Y887N probably damaging Het
Arid4a A G 12: 71,060,093 D313G probably damaging Het
Armc2 A G 10: 42,011,927 V20A probably benign Het
C2 T A 17: 34,876,456 N171I possibly damaging Het
Cdh1 C A 8: 106,668,555 N865K probably damaging Het
Cep89 T A 7: 35,417,645 V224E probably damaging Het
Dennd2d C T 3: 106,487,815 probably benign Het
Diaph1 T A 18: 37,853,355 K1157N probably damaging Het
Dsg4 T A 18: 20,462,492 L584* probably null Het
Exoc4 G A 6: 33,918,432 A795T probably benign Het
Fbln5 A T 12: 101,765,209 I242N probably damaging Het
Gls2 A G 10: 128,205,221 H394R probably damaging Het
Gm27013 C T 6: 130,675,958 C847Y possibly damaging Het
Ifna5 C A 4: 88,835,799 T92K possibly damaging Het
Ireb2 A G 9: 54,900,516 M674V probably benign Het
Itga2 C T 13: 114,839,570 V1089M possibly damaging Het
Kctd16 A T 18: 40,258,869 Y170F probably benign Het
Kif15 A G 9: 123,013,974 N45D possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mink1 A G 11: 70,606,075 K420E possibly damaging Het
Ms4a14 G T 19: 11,302,027 Q1056K probably benign Het
Olfr1053 T A 2: 86,314,398 E296V probably damaging Het
Olfr175-ps1 T C 16: 58,823,953 Y252C probably benign Het
Ovch2 T C 7: 107,781,978 E571G probably benign Het
Pmel T C 10: 128,714,381 V95A probably damaging Het
Ptger2 G T 14: 44,989,142 G60C probably benign Het
Ranbp2 T G 10: 58,476,825 S1122R probably benign Het
Rasal2 T C 1: 157,176,162 D309G probably damaging Het
Rcc2 T A 4: 140,715,919 C303S probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpini1 C T 3: 75,613,081 probably benign Het
Sgo2a G T 1: 58,019,660 E1133* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Smarcc1 G A 9: 110,132,183 probably benign Het
Tbcd A G 11: 121,592,692 E749G probably benign Het
Tmc3 G A 7: 83,599,982 A260T probably benign Het
Tnfrsf21 A G 17: 43,037,659 Y54C probably damaging Het
Uhrf1bp1l A G 10: 89,787,199 D312G possibly damaging Het
Urb1 T A 16: 90,776,163 M994L probably benign Het
Usp14 A T 18: 10,009,935 probably benign Het
Vps13a T C 19: 16,664,564 Y2233C probably damaging Het
Wdr66 G A 5: 123,298,521 V1038I probably benign Het
Wnt2 G T 6: 17,990,028 A290E probably damaging Het
Zc3h8 A T 2: 128,930,892 C225* probably null Het
Other mutations in Olfr738
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Olfr738 APN 14 50414453 missense probably benign
IGL01935:Olfr738 APN 14 50413555 missense probably benign
IGL02431:Olfr738 APN 14 50413769 missense probably damaging 1.00
BB008:Olfr738 UTSW 14 50414329 missense probably damaging 0.96
BB018:Olfr738 UTSW 14 50414329 missense probably damaging 0.96
PIT4480001:Olfr738 UTSW 14 50413915 missense probably benign 0.14
R0620:Olfr738 UTSW 14 50413697 missense probably benign 0.20
R1445:Olfr738 UTSW 14 50414401 missense probably damaging 1.00
R1831:Olfr738 UTSW 14 50414201 splice site probably null
R1915:Olfr738 UTSW 14 50414341 missense probably damaging 1.00
R4748:Olfr738 UTSW 14 50413876 missense possibly damaging 0.77
R5301:Olfr738 UTSW 14 50413573 missense probably benign 0.09
R5831:Olfr738 UTSW 14 50413982 splice site probably null
R6173:Olfr738 UTSW 14 50414197 missense possibly damaging 0.70
R6176:Olfr738 UTSW 14 50414390 missense probably damaging 1.00
R7356:Olfr738 UTSW 14 50413702 missense probably damaging 1.00
R7678:Olfr738 UTSW 14 50414014 missense probably damaging 0.98
R7931:Olfr738 UTSW 14 50414329 missense probably damaging 0.96
R8508:Olfr738 UTSW 14 50413675 missense probably benign 0.00
R8696:Olfr738 UTSW 14 50413963 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCATCATCACTGGCTTCATC -3'
(R):5'- TCACAAGGATGTTGCAGAGGC -3'

Sequencing Primer
(F):5'- ACTGGCTTCATCCTCCTGGG -3'
(R):5'- AGAGGCGCCCAGTCATGAG -3'
Posted On2016-11-21