Incidental Mutation 'V8831:Irak4'
ID44635
Institutional Source Beutler Lab
Gene Symbol Irak4
Ensembl Gene ENSMUSG00000059883
Gene Nameinterleukin-1 receptor-associated kinase 4
SynonymsIRAK-4, 8430405M07Rik, NY-REN-64, 9330209D03Rik
Accession Numbers

Ncbi RefSeq: NM_029926; VEGA: OTTMUST00000040437; MGI: 2182474

Is this an essential gene? Probably essential (E-score: 0.827) question?
Stock #V8831 () of strain 710
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location94543643-94581815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94561484 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 327 (I327T)
Ref Sequence ENSEMBL: ENSMUSP00000104871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074936] [ENSMUST00000109248]
Predicted Effect probably damaging
Transcript: ENSMUST00000074936
AA Change: I327T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074471
Gene: ENSMUSG00000059883
AA Change: I327T

DomainStartEndE-ValueType
PDB:1WH4|A 1 114 1e-78 PDB
Pfam:Pkinase_Tyr 187 454 3.3e-53 PFAM
Pfam:Pkinase 187 456 4.9e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109248
AA Change: I327T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104871
Gene: ENSMUSG00000059883
AA Change: I327T

DomainStartEndE-ValueType
Pfam:Death 20 101 1.6e-6 PFAM
Pfam:Pkinase_Tyr 187 452 1.9e-51 PFAM
Pfam:Pkinase 188 452 1.3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138306
Meta Mutation Damage Score 0.3848 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase that activates NF-kappaB in both the Toll-like receptor (TLR) and T-cell receptor (TCR) signaling pathways. The protein is essential for most innate immune responses. Mutations in this gene result in IRAK4 deficiency and recurrent invasive pneumococcal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutant mice exhibit defects of the innate immune system and show increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(5) Chemically induced(1)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsa1 A G 12: 87,269,923 N107S probably damaging Het
Arhgap23 A G 11: 97,456,545 I690V probably benign Het
Bard1 G A 1: 71,088,217 P78S probably damaging Het
Ccar1 G A 10: 62,747,406 T976I unknown Het
Cdc7 T A 5: 106,968,910 N50K probably benign Het
Cep85 C T 4: 134,156,069 E170K possibly damaging Het
Cpsf2 C T 12: 102,003,141 R757C probably damaging Het
Csmd3 A T 15: 48,457,696 D239E probably damaging Het
Dnah7b T G 1: 46,373,298 Y4022* probably null Het
Elmo3 A G 8: 105,307,061 N179S probably benign Het
H2-T24 T A 17: 36,017,324 Q89L probably damaging Het
Hist1h2bj G C 13: 22,043,281 probably benign Het
Itpr2 A T 6: 146,385,882 L157Q probably damaging Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lrrc72 G T 12: 36,208,657 T67K possibly damaging Het
Map2 T G 1: 66,415,845 I1298S probably damaging Het
Mroh2a T TN 1: 88,256,167 probably null Het
Ndst1 G A 18: 60,702,927 A428V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1369-ps1 T C 13: 21,116,003 Y104H possibly damaging Het
Olfr177 G T 16: 58,873,075 T25K probably benign Het
Olfr481 C T 7: 108,081,535 A247V probably benign Het
Plxna1 A G 6: 89,357,137 V170A probably damaging Het
Rfx6 G A 10: 51,718,208 probably null Het
Shprh G A 10: 11,186,862 D1238N probably damaging Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc9c1 A T 16: 45,577,899 I676F possibly damaging Het
Smoc1 A G 12: 81,168,255 D305G probably damaging Het
Spdef C T 17: 27,718,077 R184H probably damaging Het
Stxbp4 C T 11: 90,480,671 A535T probably benign Het
Tcp11l1 C G 2: 104,685,484 V345L probably benign Het
Ticam1 TC T 17: 56,269,969 probably null Het
Ttc28 A T 5: 111,100,712 Y177F probably benign Het
Ugt2b34 A T 5: 86,906,674 Y83N probably benign Het
Vmn2r30 G A 7: 7,334,149 R163C probably benign Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Other mutations in Irak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Irak4 APN 15 94556628 missense probably benign 0.09
IGL00688:Irak4 APN 15 94566863 missense possibly damaging 0.68
IGL01870:Irak4 APN 15 94547870 missense probably benign 0.28
IGL02740:Irak4 APN 15 94567044 makesense probably null
IGL02897:Irak4 APN 15 94553991 missense probably benign 0.00
IGL03290:Irak4 APN 15 94551899 missense probably benign 0.01
otiose UTSW 15 94561484 missense probably damaging 1.00
R0057:Irak4 UTSW 15 94553872 missense probably benign 0.00
R2010:Irak4 UTSW 15 94551806 missense probably damaging 1.00
R3751:Irak4 UTSW 15 94561595 missense probably damaging 1.00
R3752:Irak4 UTSW 15 94561595 missense probably damaging 1.00
R3753:Irak4 UTSW 15 94561595 missense probably damaging 1.00
R3973:Irak4 UTSW 15 94554740 missense possibly damaging 0.73
R4687:Irak4 UTSW 15 94566823 missense probably damaging 1.00
R4704:Irak4 UTSW 15 94566900 splice site probably null
R5001:Irak4 UTSW 15 94558273 missense possibly damaging 0.91
R5392:Irak4 UTSW 15 94556684 missense probably benign
R5392:Irak4 UTSW 15 94556685 missense probably benign 0.39
R6280:Irak4 UTSW 15 94551810 nonsense probably null
R6390:Irak4 UTSW 15 94561486 missense probably damaging 1.00
R7643:Irak4 UTSW 15 94558828 missense probably benign 0.05
X0019:Irak4 UTSW 15 94554000 missense probably benign 0.00
X0027:Irak4 UTSW 15 94551930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTTACACACTGTGGGCCAGAC -3'
(R):5'- TACCACGCCGAAGCTGTAGATGTCAG -3'

Sequencing Primer
(F):5'- TGACACACAATGTGacatgtgc -3'
(R):5'- ATTTCTCCCCGCAAAGCT -3'
Posted On2013-06-11