Incidental Mutation 'V8831:Slc15a2'
ID44636
Institutional Source Beutler Lab
Gene Symbol Slc15a2
Ensembl Gene ENSMUSG00000022899
Gene Namesolute carrier family 15 (H+/peptide transporter), member 2
Synonyms8430408C16Rik, Pept2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #V8831 () of strain 710
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location36750177-36784962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36772445 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 179 (M179T)
Ref Sequence ENSEMBL: ENSMUSP00000132663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023616] [ENSMUST00000164579] [ENSMUST00000165380] [ENSMUST00000165531] [ENSMUST00000168279]
Predicted Effect probably benign
Transcript: ENSMUST00000023616
AA Change: M210T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023616
Gene: ENSMUSG00000022899
AA Change: M210T

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:PTR2 122 500 1.7e-122 PFAM
Pfam:PTR2 593 686 2.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164579
AA Change: M210T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132029
Gene: ENSMUSG00000022899
AA Change: M210T

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:PTR2 122 244 7.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165380
SMART Domains Protein: ENSMUSP00000131395
Gene: ENSMUSG00000022899

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165531
AA Change: M179T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132663
Gene: ENSMUSG00000022899
AA Change: M179T

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:PTR2 99 469 2.4e-105 PFAM
PDB:2XUT|C 583 642 3e-10 PDB
transmembrane domain 655 677 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166399
Predicted Effect probably benign
Transcript: ENSMUST00000168279
SMART Domains Protein: ENSMUSP00000132885
Gene: ENSMUSG00000022899

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:PTR2 122 189 4.1e-27 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian kidney expresses a proton-coupled peptide transporter that is responsible for the absorption of small peptides, as well as beta-lactam antibiotics and other peptide-like drugs, from the tubular filtrate. This transporter, SLC15A2, belongs to the same gene family as SLC15A1 (MIM 600544), the proton-coupled peptide transporter found in the small intestine (Liu et al, 1995 [PubMed 7756356]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Homozygous mutant mice have impairments of dipeptide transportion, however, show no gross defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsa1 A G 12: 87,269,923 N107S probably damaging Het
Arhgap23 A G 11: 97,456,545 I690V probably benign Het
Bard1 G A 1: 71,088,217 P78S probably damaging Het
Ccar1 G A 10: 62,747,406 T976I unknown Het
Cdc7 T A 5: 106,968,910 N50K probably benign Het
Cep85 C T 4: 134,156,069 E170K possibly damaging Het
Cpsf2 C T 12: 102,003,141 R757C probably damaging Het
Csmd3 A T 15: 48,457,696 D239E probably damaging Het
Dnah7b T G 1: 46,373,298 Y4022* probably null Het
Elmo3 A G 8: 105,307,061 N179S probably benign Het
H2-T24 T A 17: 36,017,324 Q89L probably damaging Het
Hist1h2bj G C 13: 22,043,281 probably benign Het
Irak4 T C 15: 94,561,484 I327T probably damaging Het
Itpr2 A T 6: 146,385,882 L157Q probably damaging Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lrrc72 G T 12: 36,208,657 T67K possibly damaging Het
Map2 T G 1: 66,415,845 I1298S probably damaging Het
Mroh2a T TN 1: 88,256,167 probably null Het
Ndst1 G A 18: 60,702,927 A428V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1369-ps1 T C 13: 21,116,003 Y104H possibly damaging Het
Olfr177 G T 16: 58,873,075 T25K probably benign Het
Olfr481 C T 7: 108,081,535 A247V probably benign Het
Plxna1 A G 6: 89,357,137 V170A probably damaging Het
Rfx6 G A 10: 51,718,208 probably null Het
Shprh G A 10: 11,186,862 D1238N probably damaging Het
Slc9c1 A T 16: 45,577,899 I676F possibly damaging Het
Smoc1 A G 12: 81,168,255 D305G probably damaging Het
Spdef C T 17: 27,718,077 R184H probably damaging Het
Stxbp4 C T 11: 90,480,671 A535T probably benign Het
Tcp11l1 C G 2: 104,685,484 V345L probably benign Het
Ticam1 TC T 17: 56,269,969 probably null Het
Ttc28 A T 5: 111,100,712 Y177F probably benign Het
Ugt2b34 A T 5: 86,906,674 Y83N probably benign Het
Vmn2r30 G A 7: 7,334,149 R163C probably benign Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Other mutations in Slc15a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Slc15a2 APN 16 36753775 missense probably benign 0.00
IGL00703:Slc15a2 APN 16 36757791 missense probably benign 0.00
IGL00937:Slc15a2 APN 16 36751880 nonsense probably null
IGL01511:Slc15a2 APN 16 36784726 missense probably damaging 0.99
IGL01739:Slc15a2 APN 16 36756230 missense probably benign
IGL02069:Slc15a2 APN 16 36759251 missense probably benign 0.02
IGL02076:Slc15a2 APN 16 36762381 missense probably damaging 1.00
IGL02254:Slc15a2 APN 16 36760087 missense possibly damaging 0.93
IGL02387:Slc15a2 APN 16 36751775 unclassified probably null
IGL02507:Slc15a2 APN 16 36781659 missense possibly damaging 0.87
IGL02829:Slc15a2 APN 16 36757193 missense possibly damaging 0.92
IGL03114:Slc15a2 APN 16 36751905 missense probably damaging 1.00
IGL03227:Slc15a2 APN 16 36756048 critical splice donor site probably null
PIT4581001:Slc15a2 UTSW 16 36772043 missense probably benign
R0058:Slc15a2 UTSW 16 36754547 missense probably benign 0.08
R0058:Slc15a2 UTSW 16 36754547 missense probably benign 0.08
R0083:Slc15a2 UTSW 16 36782283 missense probably damaging 1.00
R0099:Slc15a2 UTSW 16 36753036 missense probably damaging 1.00
R0104:Slc15a2 UTSW 16 36774635 missense possibly damaging 0.79
R0402:Slc15a2 UTSW 16 36775598 missense probably benign 0.00
R0619:Slc15a2 UTSW 16 36759307 missense probably damaging 1.00
R0963:Slc15a2 UTSW 16 36774573 missense probably damaging 1.00
R0972:Slc15a2 UTSW 16 36757139 missense probably benign 0.00
R1440:Slc15a2 UTSW 16 36784643 splice site probably benign
R1471:Slc15a2 UTSW 16 36753791 missense probably damaging 0.99
R1569:Slc15a2 UTSW 16 36756383 missense probably benign 0.00
R1616:Slc15a2 UTSW 16 36754481 missense probably benign
R2246:Slc15a2 UTSW 16 36762361 missense probably damaging 1.00
R2405:Slc15a2 UTSW 16 36751837 nonsense probably null
R3834:Slc15a2 UTSW 16 36772128 nonsense probably null
R3835:Slc15a2 UTSW 16 36772128 nonsense probably null
R3885:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R3887:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R3888:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R3889:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R4105:Slc15a2 UTSW 16 36782393 intron probably benign
R4108:Slc15a2 UTSW 16 36782393 intron probably benign
R4254:Slc15a2 UTSW 16 36754490 missense probably benign 0.04
R4352:Slc15a2 UTSW 16 36772028 missense probably benign 0.08
R4684:Slc15a2 UTSW 16 36757849 missense probably damaging 1.00
R4747:Slc15a2 UTSW 16 36772136 missense probably damaging 0.98
R4774:Slc15a2 UTSW 16 36781695 nonsense probably null
R5151:Slc15a2 UTSW 16 36752297 missense probably damaging 1.00
R5503:Slc15a2 UTSW 16 36762385 missense probably damaging 1.00
R5649:Slc15a2 UTSW 16 36772110 nonsense probably null
R6003:Slc15a2 UTSW 16 36754548 missense probably benign 0.00
R6261:Slc15a2 UTSW 16 36761611 missense probably benign 0.25
R6329:Slc15a2 UTSW 16 36751782 missense possibly damaging 0.94
R6409:Slc15a2 UTSW 16 36761870 missense probably benign 0.00
R6523:Slc15a2 UTSW 16 36752321 missense probably benign 0.17
R7125:Slc15a2 UTSW 16 36782298 missense probably damaging 1.00
R7208:Slc15a2 UTSW 16 36756281 missense probably benign 0.02
R7234:Slc15a2 UTSW 16 36757811 missense probably benign 0.05
R7374:Slc15a2 UTSW 16 36751845 missense probably benign 0.01
R7545:Slc15a2 UTSW 16 36775602 missense probably damaging 1.00
R7559:Slc15a2 UTSW 16 36751897 missense probably benign
R7611:Slc15a2 UTSW 16 36756311 missense probably benign 0.18
R7787:Slc15a2 UTSW 16 36751866 missense probably benign 0.02
R7825:Slc15a2 UTSW 16 36753034 missense possibly damaging 0.94
T0722:Slc15a2 UTSW 16 36772445 missense probably benign
X0066:Slc15a2 UTSW 16 36753789 nonsense probably null
Z1088:Slc15a2 UTSW 16 36772445 missense probably benign
Z1176:Slc15a2 UTSW 16 36759316 critical splice acceptor site probably null
Z1176:Slc15a2 UTSW 16 36772445 missense probably benign
Z1177:Slc15a2 UTSW 16 36772445 missense probably benign
Z1177:Slc15a2 UTSW 16 36784687 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTGATTGTGACTCACGAGTCTGCC -3'
(R):5'- GAGAGCTAATGAGACGCTCATGCC -3'

Sequencing Primer
(F):5'- GACTCACGAGTCTGCCATATTTTAC -3'
(R):5'- CGTGGTAGCACAATCTGAACTTG -3'
Posted On2013-06-11