Incidental Mutation 'V8831:Olfr177'
ID44638
Institutional Source Beutler Lab
Gene Symbol Olfr177
Ensembl Gene ENSMUSG00000063137
Gene Nameolfactory receptor 177
SynonymsGA_x54KRFPKG5P-55091371-55090442, MOR184-7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #V8831 () of strain 710
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location58870955-58874768 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58873075 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 25 (T25K)
Ref Sequence ENSEMBL: ENSMUSP00000150269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072853] [ENSMUST00000217377]
Predicted Effect probably benign
Transcript: ENSMUST00000072853
AA Change: T25K

PolyPhen 2 Score 0.283 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072631
Gene: ENSMUSG00000063137
AA Change: T25K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 254 8.3e-6 PFAM
Pfam:7tm_1 41 290 1.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205920
AA Change: T25K
Predicted Effect probably benign
Transcript: ENSMUST00000217377
AA Change: T25K

PolyPhen 2 Score 0.283 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsa1 A G 12: 87,269,923 N107S probably damaging Het
Arhgap23 A G 11: 97,456,545 I690V probably benign Het
Bard1 G A 1: 71,088,217 P78S probably damaging Het
Ccar1 G A 10: 62,747,406 T976I unknown Het
Cdc7 T A 5: 106,968,910 N50K probably benign Het
Cep85 C T 4: 134,156,069 E170K possibly damaging Het
Cpsf2 C T 12: 102,003,141 R757C probably damaging Het
Csmd3 A T 15: 48,457,696 D239E probably damaging Het
Dnah7b T G 1: 46,373,298 Y4022* probably null Het
Elmo3 A G 8: 105,307,061 N179S probably benign Het
H2-T24 T A 17: 36,017,324 Q89L probably damaging Het
Hist1h2bj G C 13: 22,043,281 probably benign Het
Irak4 T C 15: 94,561,484 I327T probably damaging Het
Itpr2 A T 6: 146,385,882 L157Q probably damaging Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lrrc72 G T 12: 36,208,657 T67K possibly damaging Het
Map2 T G 1: 66,415,845 I1298S probably damaging Het
Mroh2a T TN 1: 88,256,167 probably null Het
Ndst1 G A 18: 60,702,927 A428V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1369-ps1 T C 13: 21,116,003 Y104H possibly damaging Het
Olfr481 C T 7: 108,081,535 A247V probably benign Het
Plxna1 A G 6: 89,357,137 V170A probably damaging Het
Rfx6 G A 10: 51,718,208 probably null Het
Shprh G A 10: 11,186,862 D1238N probably damaging Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc9c1 A T 16: 45,577,899 I676F possibly damaging Het
Smoc1 A G 12: 81,168,255 D305G probably damaging Het
Spdef C T 17: 27,718,077 R184H probably damaging Het
Stxbp4 C T 11: 90,480,671 A535T probably benign Het
Tcp11l1 C G 2: 104,685,484 V345L probably benign Het
Ticam1 TC T 17: 56,269,969 probably null Het
Ttc28 A T 5: 111,100,712 Y177F probably benign Het
Ugt2b34 A T 5: 86,906,674 Y83N probably benign Het
Vmn2r30 G A 7: 7,334,149 R163C probably benign Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Other mutations in Olfr177
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:Olfr177 APN 16 58873036 missense probably damaging 1.00
IGL02223:Olfr177 APN 16 58872694 missense probably damaging 1.00
R0131:Olfr177 UTSW 16 58872906 missense probably benign 0.01
R0131:Olfr177 UTSW 16 58872906 missense probably benign 0.01
R0132:Olfr177 UTSW 16 58872906 missense probably benign 0.01
R0245:Olfr177 UTSW 16 58872866 missense probably benign 0.01
R0717:Olfr177 UTSW 16 58872770 missense probably damaging 1.00
R0975:Olfr177 UTSW 16 58873150 unclassified probably null
R1037:Olfr177 UTSW 16 58872970 missense probably damaging 1.00
R1256:Olfr177 UTSW 16 58872843 nonsense probably null
R1278:Olfr177 UTSW 16 58872977 missense probably damaging 1.00
R1538:Olfr177 UTSW 16 58872898 missense probably damaging 1.00
R1992:Olfr177 UTSW 16 58872511 missense probably benign 0.43
R2173:Olfr177 UTSW 16 58872619 missense probably damaging 0.99
R2392:Olfr177 UTSW 16 58872434 missense probably damaging 1.00
R5651:Olfr177 UTSW 16 58872484 missense probably damaging 0.99
R5652:Olfr177 UTSW 16 58872484 missense probably damaging 0.99
R5653:Olfr177 UTSW 16 58872484 missense probably damaging 0.99
R8031:Olfr177 UTSW 16 58872691 missense probably benign 0.03
R8108:Olfr177 UTSW 16 58872236 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGCCATGCACTCATAGAGAGAAATCC -3'
(R):5'- CCCTGGAAGTGTCAAGTAGTCCAAAG -3'

Sequencing Primer
(F):5'- CACTCATAGAGAGAAATCCTTCTGTC -3'
(R):5'- GTAGTCCAAAGGATTTTGACAGTC -3'
Posted On2013-06-11