Incidental Mutation 'R5768:Cherp'
ID 446387
Institutional Source Beutler Lab
Gene Symbol Cherp
Ensembl Gene ENSMUSG00000052488
Gene Name calcium homeostasis endoplasmic reticulum protein
Synonyms DAN16, SCAF6, D8Wsu96e, 5730408I11Rik
MMRRC Submission 043368-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock # R5768 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 72460489-72475226 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 72463113 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 658 (D658N)
Ref Sequence ENSEMBL: ENSMUSP00000148273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064853] [ENSMUST00000079510] [ENSMUST00000121902] [ENSMUST00000212991]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000064853
SMART Domains Protein: ENSMUSP00000063244
Gene: ENSMUSG00000052794

DomainStartEndE-ValueType
low complexity region 200 216 N/A INTRINSIC
low complexity region 250 262 N/A INTRINSIC
low complexity region 320 333 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 421 432 N/A INTRINSIC
Pfam:DUF4614 438 608 2e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079510
AA Change: D669N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078469
Gene: ENSMUSG00000052488
AA Change: D669N

DomainStartEndE-ValueType
SWAP 13 65 9.76e-24 SMART
low complexity region 78 100 N/A INTRINSIC
low complexity region 107 124 N/A INTRINSIC
RPR 156 286 5.32e-2 SMART
coiled coil region 310 334 N/A INTRINSIC
low complexity region 362 385 N/A INTRINSIC
low complexity region 409 419 N/A INTRINSIC
low complexity region 439 463 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
low complexity region 526 560 N/A INTRINSIC
low complexity region 565 580 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
low complexity region 725 736 N/A INTRINSIC
low complexity region 743 829 N/A INTRINSIC
G_patch 850 900 9.8e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121902
SMART Domains Protein: ENSMUSP00000113279
Gene: ENSMUSG00000052794

DomainStartEndE-ValueType
low complexity region 200 216 N/A INTRINSIC
low complexity region 250 262 N/A INTRINSIC
low complexity region 320 333 N/A INTRINSIC
low complexity region 387 398 N/A INTRINSIC
Pfam:DUF4614 400 575 1.3e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212548
Predicted Effect probably damaging
Transcript: ENSMUST00000212991
AA Change: D658N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.6714 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 G A 5: 8,127,426 T561I probably benign Het
Akp3 T C 1: 87,127,122 I393T probably damaging Het
Atxn10 A T 15: 85,393,420 I363F probably benign Het
BC004004 A T 17: 29,282,735 S83C probably damaging Het
Bin1 T A 18: 32,426,211 probably null Het
Cacna1c A G 6: 118,697,680 I541T probably damaging Het
Cand1 A G 10: 119,211,005 V860A probably benign Het
Ccdc69 T C 11: 55,055,030 N50S possibly damaging Het
Cd209d T A 8: 3,871,968 T235S probably benign Het
Cdhr3 G T 12: 33,046,686 T591K possibly damaging Het
Clip4 T A 17: 71,806,499 probably null Het
Cryzl1 C T 16: 91,695,354 V195M probably damaging Het
Cst11 A T 2: 148,770,467 Y83* probably null Het
Ddb2 T C 2: 91,211,992 S419G possibly damaging Het
Ddi2 A T 4: 141,685,590 L4M probably damaging Het
Dip2b C A 15: 100,157,945 P393T probably benign Het
Dnmt3a G A 12: 3,885,660 probably null Het
Elf5 C T 2: 103,449,022 S196L probably damaging Het
Eps15 C G 4: 109,363,176 probably null Het
Fra10ac1 T C 19: 38,207,286 E163G probably benign Het
Gc T C 5: 89,441,266 T213A probably damaging Het
Grpel1 A T 5: 36,465,159 probably benign Het
Gsdme G A 6: 50,219,300 Q377* probably null Het
Hira T C 16: 18,935,018 probably benign Het
Hsd11b1 T A 1: 193,240,246 I168F probably damaging Het
Htr6 G A 4: 139,061,704 R347W probably damaging Het
Ipp A C 4: 116,510,770 T67P probably damaging Het
Lrfn5 G A 12: 61,839,723 R99Q probably benign Het
Madd T A 2: 91,167,829 I649F probably damaging Het
Map2k7 T A 8: 4,245,757 D368E probably benign Het
Mppe1 T G 18: 67,225,818 T360P possibly damaging Het
Msi2 A G 11: 88,717,738 F2L probably damaging Het
Nectin3 T C 16: 46,458,817 Q266R probably damaging Het
Nfasc T C 1: 132,605,145 H691R probably benign Het
Olfr1222 T C 2: 89,125,449 E94G probably benign Het
Olfr194 TGAAGAAGAA TGAAGAA 16: 59,119,972 probably benign Het
Oprm1 G A 10: 6,789,026 G51D probably damaging Het
Papss2 G A 19: 32,660,719 probably null Het
Pi4ka T C 16: 17,354,872 K549E probably benign Het
Plekha6 A G 1: 133,280,378 T596A probably benign Het
Polr2f A G 15: 79,151,645 D117G probably damaging Het
Psd T C 19: 46,312,739 E381G possibly damaging Het
Rfx6 G A 10: 51,726,880 R831H probably damaging Het
Rpp25l A T 4: 41,712,649 L42Q probably damaging Het
Ryr3 T C 2: 112,753,097 M2810V probably benign Het
Sdk1 C A 5: 142,143,871 L1616I probably benign Het
Spock2 T A 10: 60,126,207 F215I probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tchh A T 3: 93,446,181 E976V unknown Het
Tgfbr3 T C 5: 107,149,895 E213G probably benign Het
Tmed1 T C 9: 21,509,323 D71G probably benign Het
Tmtc4 T A 14: 122,933,153 K527N possibly damaging Het
Zfhx2 T C 14: 55,074,365 T291A probably benign Het
Other mutations in Cherp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Cherp APN 8 72468246 missense probably damaging 0.97
IGL00955:Cherp APN 8 72470194 missense probably damaging 0.99
R0452:Cherp UTSW 8 72461522 unclassified probably benign
R0479:Cherp UTSW 8 72463147 missense possibly damaging 0.66
R0594:Cherp UTSW 8 72462402 critical splice donor site probably null
R1734:Cherp UTSW 8 72470088 critical splice donor site probably null
R1781:Cherp UTSW 8 72467771 missense probably damaging 1.00
R1793:Cherp UTSW 8 72463150 missense probably benign 0.12
R2012:Cherp UTSW 8 72474769 missense probably damaging 0.98
R2845:Cherp UTSW 8 72466403 missense probably damaging 0.99
R3612:Cherp UTSW 8 72461996 unclassified probably benign
R3693:Cherp UTSW 8 72467911 small deletion probably benign
R3899:Cherp UTSW 8 72469936 missense possibly damaging 0.63
R3900:Cherp UTSW 8 72469936 missense possibly damaging 0.63
R3970:Cherp UTSW 8 72469951 missense possibly damaging 0.60
R4915:Cherp UTSW 8 72468397 missense probably damaging 1.00
R5512:Cherp UTSW 8 72463266 missense possibly damaging 0.66
R5556:Cherp UTSW 8 72467980 missense probably damaging 0.99
R5739:Cherp UTSW 8 72467815 small deletion probably benign
R5824:Cherp UTSW 8 72462258 unclassified probably benign
R5963:Cherp UTSW 8 72461535 unclassified probably benign
R6255:Cherp UTSW 8 72470881 missense probably damaging 0.99
R7145:Cherp UTSW 8 72468386 missense
R7538:Cherp UTSW 8 72462419 missense
R7578:Cherp UTSW 8 72464258 missense
R8329:Cherp UTSW 8 72462008 missense
RF001:Cherp UTSW 8 72462049 frame shift probably null
RF007:Cherp UTSW 8 72462059 small deletion probably benign
RF036:Cherp UTSW 8 72462044 frame shift probably null
RF036:Cherp UTSW 8 72462047 frame shift probably null
RF059:Cherp UTSW 8 72462055 frame shift probably null
T0722:Cherp UTSW 8 72462034 small deletion probably benign
T0975:Cherp UTSW 8 72462034 small deletion probably benign
Z1176:Cherp UTSW 8 72470953 missense
Z1177:Cherp UTSW 8 72462916 missense
Z1177:Cherp UTSW 8 72475135 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCATGATCCTCCAGCTGTAGG -3'
(R):5'- TTTTGCAGACATGGGACCCC -3'

Sequencing Primer
(F):5'- CTGTAGGAGAGCATAACTGTTGCC -3'
(R):5'- GACATGGGACCCCCTCATC -3'
Posted On 2016-11-21