Incidental Mutation 'V8831:Spdef'
ID44639
Institutional Source Beutler Lab
Gene Symbol Spdef
Ensembl Gene ENSMUSG00000024215
Gene NameSAM pointed domain containing ets transcription factor
SynonymsPse, PDEF
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #V8831 () of strain 710
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location27714352-27728951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27718077 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 184 (R184H)
Ref Sequence ENSEMBL: ENSMUSP00000127056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025054] [ENSMUST00000114870] [ENSMUST00000138970] [ENSMUST00000167489]
Predicted Effect probably damaging
Transcript: ENSMUST00000025054
AA Change: R184H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025054
Gene: ENSMUSG00000024215
AA Change: R184H

DomainStartEndE-ValueType
SAM_PNT 121 203 4.68e-33 SMART
ETS 238 325 4.06e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114870
AA Change: R184H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110520
Gene: ENSMUSG00000024215
AA Change: R184H

DomainStartEndE-ValueType
SAM_PNT 121 203 4.68e-33 SMART
ETS 238 325 4.06e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127622
Predicted Effect probably benign
Transcript: ENSMUST00000138970
Predicted Effect probably damaging
Transcript: ENSMUST00000167489
AA Change: R184H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127056
Gene: ENSMUSG00000024215
AA Change: R184H

DomainStartEndE-ValueType
SAM_PNT 121 203 4.68e-33 SMART
ETS 238 325 4.06e-45 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele have reduced numbers of intestinal and respiratory mucosa goblet cells. Increased inflammation of the gastric antrum has also been seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsa1 A G 12: 87,269,923 N107S probably damaging Het
Arhgap23 A G 11: 97,456,545 I690V probably benign Het
Bard1 G A 1: 71,088,217 P78S probably damaging Het
Ccar1 G A 10: 62,747,406 T976I unknown Het
Cdc7 T A 5: 106,968,910 N50K probably benign Het
Cep85 C T 4: 134,156,069 E170K possibly damaging Het
Cpsf2 C T 12: 102,003,141 R757C probably damaging Het
Csmd3 A T 15: 48,457,696 D239E probably damaging Het
Dnah7b T G 1: 46,373,298 Y4022* probably null Het
Elmo3 A G 8: 105,307,061 N179S probably benign Het
H2-T24 T A 17: 36,017,324 Q89L probably damaging Het
Hist1h2bj G C 13: 22,043,281 probably benign Het
Irak4 T C 15: 94,561,484 I327T probably damaging Het
Itpr2 A T 6: 146,385,882 L157Q probably damaging Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lrrc72 G T 12: 36,208,657 T67K possibly damaging Het
Map2 T G 1: 66,415,845 I1298S probably damaging Het
Mroh2a T TN 1: 88,256,167 probably null Het
Ndst1 G A 18: 60,702,927 A428V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1369-ps1 T C 13: 21,116,003 Y104H possibly damaging Het
Olfr177 G T 16: 58,873,075 T25K probably benign Het
Olfr481 C T 7: 108,081,535 A247V probably benign Het
Plxna1 A G 6: 89,357,137 V170A probably damaging Het
Rfx6 G A 10: 51,718,208 probably null Het
Shprh G A 10: 11,186,862 D1238N probably damaging Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc9c1 A T 16: 45,577,899 I676F possibly damaging Het
Smoc1 A G 12: 81,168,255 D305G probably damaging Het
Stxbp4 C T 11: 90,480,671 A535T probably benign Het
Tcp11l1 C G 2: 104,685,484 V345L probably benign Het
Ticam1 TC T 17: 56,269,969 probably null Het
Ttc28 A T 5: 111,100,712 Y177F probably benign Het
Ugt2b34 A T 5: 86,906,674 Y83N probably benign Het
Vmn2r30 G A 7: 7,334,149 R163C probably benign Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Other mutations in Spdef
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0211:Spdef UTSW 17 27714920 missense probably damaging 1.00
R0211:Spdef UTSW 17 27714920 missense probably damaging 1.00
R0497:Spdef UTSW 17 27718058 missense probably benign 0.02
R0972:Spdef UTSW 17 27715023 missense probably damaging 1.00
R2255:Spdef UTSW 17 27720295 missense probably benign 0.01
R4930:Spdef UTSW 17 27718162 missense probably damaging 1.00
R7151:Spdef UTSW 17 27720160 missense possibly damaging 0.92
R7339:Spdef UTSW 17 27720245 missense probably benign
R7392:Spdef UTSW 17 27717288 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGTCACCTGAGTGCATCTGTCTCC -3'
(R):5'- CACCAGCAGCCTTGAACTAGTGTG -3'

Sequencing Primer
(F):5'- TTCATCTCAGACCTCTAAGGGAAAG -3'
(R):5'- AGCCTTGAACTAGTGTGTATCTC -3'
Posted On2013-06-11