Incidental Mutation 'R5768:Rfx6'
ID 446391
Institutional Source Beutler Lab
Gene Symbol Rfx6
Ensembl Gene ENSMUSG00000019900
Gene Name regulatory factor X, 6
Synonyms Rfxdc1, 4930572O07Rik
MMRRC Submission 043368-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5768 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 51677756-51730432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 51726880 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 831 (R831H)
Ref Sequence ENSEMBL: ENSMUSP00000151430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050455] [ENSMUST00000122922] [ENSMUST00000219364]
AlphaFold Q8C7R7
Predicted Effect probably benign
Transcript: ENSMUST00000050455
AA Change: R601H

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000057384
Gene: ENSMUSG00000019900
AA Change: R601H

DomainStartEndE-ValueType
Blast:HisKA 91 153 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000122922
AA Change: R865H

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116057
Gene: ENSMUSG00000019900
AA Change: R865H

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 120 198 1.9e-33 PFAM
Blast:HisKA 355 417 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217662
Predicted Effect probably damaging
Transcript: ENSMUST00000219364
AA Change: R831H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000219771
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear protein encoded by this gene is a member of the regulatory factor X (RFX) family of transcription factors. Studies in mice suggest that this gene is specifically required for the differentiation of islet cells for the production of insulin, but not for the differentiation of pancreatic polypeptide-producing cells. It regulates the transcription factors involved in beta-cell maturation and function, thus, restricting the expression of the beta-cell differentiation and specification genes. Mutations in this gene are associated with Mitchell-Riley syndrome, which is characterized by neonatal diabetes with pancreatic hypoplasia, duodenal and jejunal atresia, and gall bladder agenesis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes fail to feed normally, show small bowel obstruction and die within 2 days of birth. Mutants fail to generate any of the normal islet cell types except for pancreatic-polypeptide-producing cells. Some display a reduced pancreas size; however, primary cilia formation in islets is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 G A 5: 8,127,426 T561I probably benign Het
Akp3 T C 1: 87,127,122 I393T probably damaging Het
Atxn10 A T 15: 85,393,420 I363F probably benign Het
BC004004 A T 17: 29,282,735 S83C probably damaging Het
Bin1 T A 18: 32,426,211 probably null Het
Cacna1c A G 6: 118,697,680 I541T probably damaging Het
Cand1 A G 10: 119,211,005 V860A probably benign Het
Ccdc69 T C 11: 55,055,030 N50S possibly damaging Het
Cd209d T A 8: 3,871,968 T235S probably benign Het
Cdhr3 G T 12: 33,046,686 T591K possibly damaging Het
Cherp C T 8: 72,463,113 D658N probably damaging Het
Clip4 T A 17: 71,806,499 probably null Het
Cryzl1 C T 16: 91,695,354 V195M probably damaging Het
Cst11 A T 2: 148,770,467 Y83* probably null Het
Ddb2 T C 2: 91,211,992 S419G possibly damaging Het
Ddi2 A T 4: 141,685,590 L4M probably damaging Het
Dip2b C A 15: 100,157,945 P393T probably benign Het
Dnmt3a G A 12: 3,885,660 probably null Het
Elf5 C T 2: 103,449,022 S196L probably damaging Het
Eps15 C G 4: 109,363,176 probably null Het
Fra10ac1 T C 19: 38,207,286 E163G probably benign Het
Gc T C 5: 89,441,266 T213A probably damaging Het
Grpel1 A T 5: 36,465,159 probably benign Het
Gsdme G A 6: 50,219,300 Q377* probably null Het
Hira T C 16: 18,935,018 probably benign Het
Hsd11b1 T A 1: 193,240,246 I168F probably damaging Het
Htr6 G A 4: 139,061,704 R347W probably damaging Het
Ipp A C 4: 116,510,770 T67P probably damaging Het
Lrfn5 G A 12: 61,839,723 R99Q probably benign Het
Madd T A 2: 91,167,829 I649F probably damaging Het
Map2k7 T A 8: 4,245,757 D368E probably benign Het
Mppe1 T G 18: 67,225,818 T360P possibly damaging Het
Msi2 A G 11: 88,717,738 F2L probably damaging Het
Nectin3 T C 16: 46,458,817 Q266R probably damaging Het
Nfasc T C 1: 132,605,145 H691R probably benign Het
Olfr1222 T C 2: 89,125,449 E94G probably benign Het
Olfr194 TGAAGAAGAA TGAAGAA 16: 59,119,972 probably benign Het
Oprm1 G A 10: 6,789,026 G51D probably damaging Het
Papss2 G A 19: 32,660,719 probably null Het
Pi4ka T C 16: 17,354,872 K549E probably benign Het
Plekha6 A G 1: 133,280,378 T596A probably benign Het
Polr2f A G 15: 79,151,645 D117G probably damaging Het
Psd T C 19: 46,312,739 E381G possibly damaging Het
Rpp25l A T 4: 41,712,649 L42Q probably damaging Het
Ryr3 T C 2: 112,753,097 M2810V probably benign Het
Sdk1 C A 5: 142,143,871 L1616I probably benign Het
Spock2 T A 10: 60,126,207 F215I probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tchh A T 3: 93,446,181 E976V unknown Het
Tgfbr3 T C 5: 107,149,895 E213G probably benign Het
Tmed1 T C 9: 21,509,323 D71G probably benign Het
Tmtc4 T A 14: 122,933,153 K527N possibly damaging Het
Zfhx2 T C 14: 55,074,365 T291A probably benign Het
Other mutations in Rfx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Rfx6 APN 10 51681886 missense probably damaging 1.00
IGL00816:Rfx6 APN 10 51678405 missense probably benign 0.16
IGL01639:Rfx6 APN 10 51715906 nonsense probably null
IGL01721:Rfx6 APN 10 51723077 missense probably damaging 1.00
IGL01861:Rfx6 APN 10 51721579 missense probably damaging 1.00
IGL02103:Rfx6 APN 10 51726856 missense possibly damaging 0.93
IGL02113:Rfx6 APN 10 51678012 missense probably benign
IGL02479:Rfx6 APN 10 51678328 missense probably benign 0.07
IGL02592:Rfx6 APN 10 51716023 missense probably damaging 1.00
IGL02635:Rfx6 APN 10 51716026 missense possibly damaging 0.80
IGL02891:Rfx6 APN 10 51723846 missense possibly damaging 0.64
IGL03153:Rfx6 APN 10 51723121 nonsense probably null
IGL03263:Rfx6 APN 10 51725807 missense probably benign 0.00
IGL03373:Rfx6 APN 10 51720000 missense probably damaging 0.99
bulky UTSW 10 51678333 missense probably benign 0.00
R0060:Rfx6 UTSW 10 51677840 missense probably benign 0.00
R0433:Rfx6 UTSW 10 51720028 missense probably damaging 1.00
R1329:Rfx6 UTSW 10 51693737 missense probably damaging 1.00
R1709:Rfx6 UTSW 10 51678402 missense possibly damaging 0.64
R1820:Rfx6 UTSW 10 51723125 critical splice donor site probably null
R2017:Rfx6 UTSW 10 51721604 missense possibly damaging 0.50
R2020:Rfx6 UTSW 10 51720057 critical splice donor site probably null
R2044:Rfx6 UTSW 10 51718126 missense probably benign 0.16
R2495:Rfx6 UTSW 10 51726675 splice site probably benign
R2655:Rfx6 UTSW 10 51693777 splice site probably benign
R2912:Rfx6 UTSW 10 51718130 missense probably damaging 1.00
R3159:Rfx6 UTSW 10 51726720 missense probably damaging 1.00
R4036:Rfx6 UTSW 10 51726746 missense probably damaging 1.00
R4536:Rfx6 UTSW 10 51723784 missense probably benign 0.16
R4791:Rfx6 UTSW 10 51719944 splice site probably null
R4945:Rfx6 UTSW 10 51726851 nonsense probably null
R5223:Rfx6 UTSW 10 51677996 nonsense probably null
R5233:Rfx6 UTSW 10 51712091 nonsense probably null
R5448:Rfx6 UTSW 10 51683637 missense probably damaging 1.00
R5600:Rfx6 UTSW 10 51723061 missense probably damaging 1.00
R5858:Rfx6 UTSW 10 51725868 missense probably benign 0.00
R5949:Rfx6 UTSW 10 51678333 missense probably benign 0.00
R6001:Rfx6 UTSW 10 51718211 splice site probably null
R6003:Rfx6 UTSW 10 51708587 missense probably damaging 1.00
R6118:Rfx6 UTSW 10 51711866 missense possibly damaging 0.91
R6629:Rfx6 UTSW 10 51725490 missense probably benign 0.02
R6876:Rfx6 UTSW 10 51719991 missense probably damaging 1.00
R6894:Rfx6 UTSW 10 51716039 missense probably damaging 1.00
R6912:Rfx6 UTSW 10 51723853 missense probably benign 0.00
R7130:Rfx6 UTSW 10 51678380 nonsense probably null
R7574:Rfx6 UTSW 10 51681818 missense probably benign 0.17
R7845:Rfx6 UTSW 10 51678026 missense probably benign 0.05
R8188:Rfx6 UTSW 10 51718196 missense probably benign 0.05
R8338:Rfx6 UTSW 10 51718094 missense probably damaging 0.96
R8710:Rfx6 UTSW 10 51725405 missense probably damaging 1.00
R8716:Rfx6 UTSW 10 51681872 missense probably damaging 1.00
R8982:Rfx6 UTSW 10 51723819 missense probably benign 0.14
R9104:Rfx6 UTSW 10 51723010 missense probably damaging 1.00
R9154:Rfx6 UTSW 10 51721504 missense probably benign 0.01
R9188:Rfx6 UTSW 10 51718167 missense probably benign 0.04
R9388:Rfx6 UTSW 10 51678021 missense possibly damaging 0.60
V8831:Rfx6 UTSW 10 51718208 critical splice donor site probably null
X0023:Rfx6 UTSW 10 51678411 missense probably damaging 1.00
Z1176:Rfx6 UTSW 10 51718093 missense probably benign 0.05
Z1176:Rfx6 UTSW 10 51725831 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATAAACTACTCAGAGGCACATAGGC -3'
(R):5'- TCAAATGCCTTTGACAAGCTG -3'

Sequencing Primer
(F):5'- GCACATAGGCTTGGATCGATG -3'
(R):5'- TCTGGATGAGATAACAGATCTTAGAG -3'
Posted On 2016-11-21