Incidental Mutation 'R5768:Susd2'
ID446393
Institutional Source Beutler Lab
Gene Symbol Susd2
Ensembl Gene ENSMUSG00000006342
Gene Namesushi domain containing 2
Synonyms1200011D11Rik
MMRRC Submission 043368-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R5768 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75636706-75644008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75638019 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 581 (A581T)
Ref Sequence ENSEMBL: ENSMUSP00000076802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077610] [ENSMUST00000095541]
PDB Structure
Solution structure of RSGI RUH-041, a SMB-like domain from mouse cDNA [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000077610
AA Change: A581T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076802
Gene: ENSMUSG00000006342
AA Change: A581T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
AMOP 162 310 4.09e-82 SMART
VWD 313 489 1.9e-19 SMART
CCP 602 655 3.37e-17 SMART
transmembrane domain 663 685 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095541
AA Change: A701T

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093197
Gene: ENSMUSG00000006342
AA Change: A701T

DomainStartEndE-ValueType
SO 25 64 4.77e-2 SMART
AMOP 282 430 4.09e-82 SMART
VWD 433 609 1.9e-19 SMART
CCP 722 775 3.37e-17 SMART
transmembrane domain 783 805 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219733
Meta Mutation Damage Score 0.2204 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 G A 5: 8,127,426 T561I probably benign Het
Akp3 T C 1: 87,127,122 I393T probably damaging Het
Atxn10 A T 15: 85,393,420 I363F probably benign Het
BC004004 A T 17: 29,282,735 S83C probably damaging Het
Bin1 T A 18: 32,426,211 probably null Het
Cacna1c A G 6: 118,697,680 I541T probably damaging Het
Cand1 A G 10: 119,211,005 V860A probably benign Het
Ccdc69 T C 11: 55,055,030 N50S possibly damaging Het
Cd209d T A 8: 3,871,968 T235S probably benign Het
Cdhr3 G T 12: 33,046,686 T591K possibly damaging Het
Cherp C T 8: 72,463,113 D658N probably damaging Het
Clip4 T A 17: 71,806,499 probably null Het
Cryzl1 C T 16: 91,695,354 V195M probably damaging Het
Cst11 A T 2: 148,770,467 Y83* probably null Het
Ddb2 T C 2: 91,211,992 S419G possibly damaging Het
Ddi2 A T 4: 141,685,590 L4M probably damaging Het
Dip2b C A 15: 100,157,945 P393T probably benign Het
Dnmt3a G A 12: 3,885,660 probably null Het
Elf5 C T 2: 103,449,022 S196L probably damaging Het
Eps15 C G 4: 109,363,176 probably null Het
Fra10ac1 T C 19: 38,207,286 E163G probably benign Het
Gc T C 5: 89,441,266 T213A probably damaging Het
Grpel1 A T 5: 36,465,159 probably benign Het
Gsdme G A 6: 50,219,300 Q377* probably null Het
Hira T C 16: 18,935,018 probably benign Het
Hsd11b1 T A 1: 193,240,246 I168F probably damaging Het
Htr6 G A 4: 139,061,704 R347W probably damaging Het
Ipp A C 4: 116,510,770 T67P probably damaging Het
Lrfn5 G A 12: 61,839,723 R99Q probably benign Het
Madd T A 2: 91,167,829 I649F probably damaging Het
Map2k7 T A 8: 4,245,757 D368E probably benign Het
Mppe1 T G 18: 67,225,818 T360P possibly damaging Het
Msi2 A G 11: 88,717,738 F2L probably damaging Het
Nectin3 T C 16: 46,458,817 Q266R probably damaging Het
Nfasc T C 1: 132,605,145 H691R probably benign Het
Olfr1222 T C 2: 89,125,449 E94G probably benign Het
Olfr194 TGAAGAAGAA TGAAGAA 16: 59,119,972 probably benign Het
Oprm1 G A 10: 6,789,026 G51D probably damaging Het
Papss2 G A 19: 32,660,719 probably null Het
Pi4ka T C 16: 17,354,872 K549E probably benign Het
Plekha6 A G 1: 133,280,378 T596A probably benign Het
Polr2f A G 15: 79,151,645 D117G probably damaging Het
Psd T C 19: 46,312,739 E381G possibly damaging Het
Rfx6 G A 10: 51,726,880 R831H probably damaging Het
Rpp25l A T 4: 41,712,649 L42Q probably damaging Het
Ryr3 T C 2: 112,753,097 M2810V probably benign Het
Sdk1 C A 5: 142,143,871 L1616I probably benign Het
Spock2 T A 10: 60,126,207 F215I probably damaging Het
Tchh A T 3: 93,446,181 E976V unknown Het
Tgfbr3 T C 5: 107,149,895 E213G probably benign Het
Tmed1 T C 9: 21,509,323 D71G probably benign Het
Tmtc4 T A 14: 122,933,153 K527N possibly damaging Het
Zfhx2 T C 14: 55,074,365 T291A probably benign Het
Other mutations in Susd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Susd2 APN 10 75638048 missense probably benign 0.02
IGL00907:Susd2 APN 10 75640931 missense probably benign 0.04
IGL01155:Susd2 APN 10 75640892 missense possibly damaging 0.87
IGL01677:Susd2 APN 10 75639431 missense possibly damaging 0.91
IGL02146:Susd2 APN 10 75638433 missense possibly damaging 0.79
IGL02273:Susd2 APN 10 75640938 missense possibly damaging 0.94
IGL02386:Susd2 APN 10 75640095 missense probably damaging 0.97
IGL02475:Susd2 APN 10 75637499 critical splice donor site probably null
IGL03218:Susd2 APN 10 75642625 missense probably benign
PIT4418001:Susd2 UTSW 10 75638349 missense probably benign 0.24
R0135:Susd2 UTSW 10 75638514 missense probably damaging 1.00
R0396:Susd2 UTSW 10 75639911 missense probably damaging 1.00
R0401:Susd2 UTSW 10 75638603 splice site probably benign
R0608:Susd2 UTSW 10 75638235 missense probably benign 0.45
R0636:Susd2 UTSW 10 75639350 missense probably damaging 1.00
R1470:Susd2 UTSW 10 75638054 missense probably damaging 1.00
R1470:Susd2 UTSW 10 75638054 missense probably damaging 1.00
R1619:Susd2 UTSW 10 75638044 missense possibly damaging 0.66
R1634:Susd2 UTSW 10 75637555 missense probably benign 0.04
R1866:Susd2 UTSW 10 75639732 missense probably damaging 0.98
R4354:Susd2 UTSW 10 75639728 missense probably damaging 0.99
R4451:Susd2 UTSW 10 75639398 missense probably damaging 1.00
R4721:Susd2 UTSW 10 75638130 missense probably benign 0.00
R5546:Susd2 UTSW 10 75642218 missense probably benign 0.01
R5769:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5770:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5771:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5960:Susd2 UTSW 10 75639936 missense probably damaging 1.00
R6152:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R6153:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R6259:Susd2 UTSW 10 75638046 missense probably damaging 1.00
R6291:Susd2 UTSW 10 75637574 missense possibly damaging 0.61
R7106:Susd2 UTSW 10 75638053 missense probably damaging 1.00
R7232:Susd2 UTSW 10 75639851 missense probably damaging 1.00
R7297:Susd2 UTSW 10 75642568 missense probably benign 0.19
R7326:Susd2 UTSW 10 75642565 missense probably benign 0.00
R7905:Susd2 UTSW 10 75639657 nonsense probably null
R7988:Susd2 UTSW 10 75639657 nonsense probably null
X0025:Susd2 UTSW 10 75640572 nonsense probably null
Z1177:Susd2 UTSW 10 75640478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATCCTTCCAGGTACCTCAAGC -3'
(R):5'- GGTCTACCAATTCGTGTACGG -3'

Sequencing Primer
(F):5'- GGTAGCCAGCCACAGGATAC -3'
(R):5'- ATTCGTGTACGGACCCAAG -3'
Posted On2016-11-21