Incidental Mutation 'V8831:H2-T24'
ID44640
Institutional Source Beutler Lab
Gene Symbol H2-T24
Ensembl Gene ENSMUSG00000053835
Gene Namehistocompatibility 2, T region locus 24
SynonymsH-2T24
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #V8831 () of strain 710
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location36005695-36020560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36017324 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 89 (Q89L)
Ref Sequence ENSEMBL: ENSMUSP00000133476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113760] [ENSMUST00000174063]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113760
AA Change: Q89L

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109389
Gene: ENSMUSG00000053835
AA Change: Q89L

DomainStartEndE-ValueType
Pfam:MHC_I 18 204 3.2e-46 PFAM
IGc1 223 294 2.61e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173900
Predicted Effect probably damaging
Transcript: ENSMUST00000174063
AA Change: Q89L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133476
Gene: ENSMUSG00000053835
AA Change: Q89L

DomainStartEndE-ValueType
Pfam:MHC_I 18 114 1.3e-23 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsa1 A G 12: 87,269,923 N107S probably damaging Het
Arhgap23 A G 11: 97,456,545 I690V probably benign Het
Bard1 G A 1: 71,088,217 P78S probably damaging Het
Ccar1 G A 10: 62,747,406 T976I unknown Het
Cdc7 T A 5: 106,968,910 N50K probably benign Het
Cep85 C T 4: 134,156,069 E170K possibly damaging Het
Cpsf2 C T 12: 102,003,141 R757C probably damaging Het
Csmd3 A T 15: 48,457,696 D239E probably damaging Het
Dnah7b T G 1: 46,373,298 Y4022* probably null Het
Elmo3 A G 8: 105,307,061 N179S probably benign Het
Hist1h2bj G C 13: 22,043,281 probably benign Het
Irak4 T C 15: 94,561,484 I327T probably damaging Het
Itpr2 A T 6: 146,385,882 L157Q probably damaging Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lrrc72 G T 12: 36,208,657 T67K possibly damaging Het
Map2 T G 1: 66,415,845 I1298S probably damaging Het
Mroh2a T TN 1: 88,256,167 probably null Het
Ndst1 G A 18: 60,702,927 A428V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1369-ps1 T C 13: 21,116,003 Y104H possibly damaging Het
Olfr177 G T 16: 58,873,075 T25K probably benign Het
Olfr481 C T 7: 108,081,535 A247V probably benign Het
Plxna1 A G 6: 89,357,137 V170A probably damaging Het
Rfx6 G A 10: 51,718,208 probably null Het
Shprh G A 10: 11,186,862 D1238N probably damaging Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc9c1 A T 16: 45,577,899 I676F possibly damaging Het
Smoc1 A G 12: 81,168,255 D305G probably damaging Het
Spdef C T 17: 27,718,077 R184H probably damaging Het
Stxbp4 C T 11: 90,480,671 A535T probably benign Het
Tcp11l1 C G 2: 104,685,484 V345L probably benign Het
Ticam1 TC T 17: 56,269,969 probably null Het
Ttc28 A T 5: 111,100,712 Y177F probably benign Het
Ugt2b34 A T 5: 86,906,674 Y83N probably benign Het
Vmn2r30 G A 7: 7,334,149 R163C probably benign Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Other mutations in H2-T24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:H2-T24 APN 17 36017236 splice site probably benign
IGL02268:H2-T24 APN 17 36017372 missense probably damaging 1.00
IGL02620:H2-T24 APN 17 36017291 missense probably damaging 1.00
IGL03192:H2-T24 APN 17 36015476 nonsense probably null
IGL03387:H2-T24 APN 17 36006779 missense unknown
R0131:H2-T24 UTSW 17 36014986 missense probably damaging 0.98
R0131:H2-T24 UTSW 17 36014986 missense probably damaging 0.98
R0132:H2-T24 UTSW 17 36014986 missense probably damaging 0.98
R0334:H2-T24 UTSW 17 36014880 missense possibly damaging 0.75
R0531:H2-T24 UTSW 17 36015571 missense probably benign
R0678:H2-T24 UTSW 17 36017441 missense probably damaging 1.00
R1161:H2-T24 UTSW 17 36014996 nonsense probably null
R1310:H2-T24 UTSW 17 36014996 nonsense probably null
R1726:H2-T24 UTSW 17 36015621 missense probably benign 0.01
R3891:H2-T24 UTSW 17 36015438 missense possibly damaging 0.59
R3948:H2-T24 UTSW 17 36017372 missense probably damaging 1.00
R4106:H2-T24 UTSW 17 36017478 missense possibly damaging 0.65
R4182:H2-T24 UTSW 17 36015484 missense possibly damaging 0.81
R4229:H2-T24 UTSW 17 36014829 missense probably benign 0.06
R5220:H2-T24 UTSW 17 36014670 missense probably benign 0.12
R6257:H2-T24 UTSW 17 36014682 missense probably benign 0.01
R7081:H2-T24 UTSW 17 36017452 missense probably damaging 0.97
R7543:H2-T24 UTSW 17 36014851 missense possibly damaging 0.70
R7739:H2-T24 UTSW 17 36014591 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CATTTGGGTTTCAAAGAGGCGCTG -3'
(R):5'- AGGGTCGCACTCTCTGCATTACTG -3'

Sequencing Primer
(F):5'- GACATTAGAGTGCCTTCCCATAG -3'
(R):5'- ACTCTCTGCATTACTGTTACTCAG -3'
Posted On2013-06-11