Mutagenetix > Incidental Mutation

Incidental Mutation 'R5768:Dip2b'

446403

Institutional Source

Beutler Lab

Gene Symbol

Dip2b

Ensembl Gene

ENSMUSG00000023026

Gene Name

disco interacting protein 2 homolog B

Synonyms

MMRRC Submission

043368-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.628) question?

Stock #

R5768 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100038664-100219473 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 100157945 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 393 (P393T)

Ref Sequence

ENSEMBL: ENSMUSP00000097777 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]

AlphaFold

Q3UH60

Predicted Effect

probably benign
Transcript: ENSMUST00000023768
AA Change: P159T

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: P159T

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	109	584	9.5e-26	PFAM
Pfam:AMP-binding	760	1235	1.2e-52	PFAM
low complexity region	1299	1311	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100203
AA Change: P393T

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: P393T

Domain	Start	End	E-Value	Type
DMAP_binding	12	130	1e-42	SMART
low complexity region	152	168	N/A	INTRINSIC
low complexity region	181	192	N/A	INTRINSIC
Pfam:AMP-binding	341	817	2e-26	PFAM
Pfam:AMP-binding	993	1468	1.8e-64	PFAM
low complexity region	1532	1544	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108971
AA Change: P159T

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: P159T

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	108	583	9.5e-26	PFAM
Pfam:AMP-binding	759	1234	1.2e-52	PFAM
low complexity region	1298	1310	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230733

Meta Mutation Damage Score

0.0900

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam22	G	A	5: 8,127,426	T561I	probably benign	Het
Akp3	T	C	1: 87,127,122	I393T	probably damaging	Het
Atxn10	A	T	15: 85,393,420	I363F	probably benign	Het
BC004004	A	T	17: 29,282,735	S83C	probably damaging	Het
Bin1	T	A	18: 32,426,211		probably null	Het
Cacna1c	A	G	6: 118,697,680	I541T	probably damaging	Het
Cand1	A	G	10: 119,211,005	V860A	probably benign	Het
Ccdc69	T	C	11: 55,055,030	N50S	possibly damaging	Het
Cd209d	T	A	8: 3,871,968	T235S	probably benign	Het
Cdhr3	G	T	12: 33,046,686	T591K	possibly damaging	Het
Cherp	C	T	8: 72,463,113	D658N	probably damaging	Het
Clip4	T	A	17: 71,806,499		probably null	Het
Cryzl1	C	T	16: 91,695,354	V195M	probably damaging	Het
Cst11	A	T	2: 148,770,467	Y83*	probably null	Het
Ddb2	T	C	2: 91,211,992	S419G	possibly damaging	Het
Ddi2	A	T	4: 141,685,590	L4M	probably damaging	Het
Dnmt3a	G	A	12: 3,885,660		probably null	Het
Elf5	C	T	2: 103,449,022	S196L	probably damaging	Het
Eps15	C	G	4: 109,363,176		probably null	Het
Fra10ac1	T	C	19: 38,207,286	E163G	probably benign	Het
Gc	T	C	5: 89,441,266	T213A	probably damaging	Het
Grpel1	A	T	5: 36,465,159		probably benign	Het
Gsdme	G	A	6: 50,219,300	Q377*	probably null	Het
Hira	T	C	16: 18,935,018		probably benign	Het
Hsd11b1	T	A	1: 193,240,246	I168F	probably damaging	Het
Htr6	G	A	4: 139,061,704	R347W	probably damaging	Het
Ipp	A	C	4: 116,510,770	T67P	probably damaging	Het
Lrfn5	G	A	12: 61,839,723	R99Q	probably benign	Het
Madd	T	A	2: 91,167,829	I649F	probably damaging	Het
Map2k7	T	A	8: 4,245,757	D368E	probably benign	Het
Mppe1	T	G	18: 67,225,818	T360P	possibly damaging	Het
Msi2	A	G	11: 88,717,738	F2L	probably damaging	Het
Nectin3	T	C	16: 46,458,817	Q266R	probably damaging	Het
Nfasc	T	C	1: 132,605,145	H691R	probably benign	Het
Olfr1222	T	C	2: 89,125,449	E94G	probably benign	Het
Olfr194	TGAAGAAGAA	TGAAGAA	16: 59,119,972		probably benign	Het
Oprm1	G	A	10: 6,789,026	G51D	probably damaging	Het
Papss2	G	A	19: 32,660,719		probably null	Het
Pi4ka	T	C	16: 17,354,872	K549E	probably benign	Het
Plekha6	A	G	1: 133,280,378	T596A	probably benign	Het
Polr2f	A	G	15: 79,151,645	D117G	probably damaging	Het
Psd	T	C	19: 46,312,739	E381G	possibly damaging	Het
Rfx6	G	A	10: 51,726,880	R831H	probably damaging	Het
Rpp25l	A	T	4: 41,712,649	L42Q	probably damaging	Het
Ryr3	T	C	2: 112,753,097	M2810V	probably benign	Het
Sdk1	C	A	5: 142,143,871	L1616I	probably benign	Het
Spock2	T	A	10: 60,126,207	F215I	probably damaging	Het
Susd2	C	T	10: 75,638,019	A581T	probably damaging	Het
Tchh	A	T	3: 93,446,181	E976V	unknown	Het
Tgfbr3	T	C	5: 107,149,895	E213G	probably benign	Het
Tmed1	T	C	9: 21,509,323	D71G	probably benign	Het
Tmtc4	T	A	14: 122,933,153	K527N	possibly damaging	Het
Zfhx2	T	C	14: 55,074,365	T291A	probably benign	Het

Other mutations in Dip2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Dip2b	APN	15	100174501	missense	probably damaging	1.00
IGL01716:Dip2b	APN	15	100209636	missense	probably benign	0.00
IGL01893:Dip2b	APN	15	100171220	splice site	probably benign
IGL01915:Dip2b	APN	15	100178511	missense	probably damaging	1.00
IGL02125:Dip2b	APN	15	100186250	missense	possibly damaging	0.60
IGL02200:Dip2b	APN	15	100151202	missense	possibly damaging	0.93
IGL02506:Dip2b	APN	15	100157281	missense	probably damaging	1.00
IGL02571:Dip2b	APN	15	100157885	missense	possibly damaging	0.93
IGL02706:Dip2b	APN	15	100215311	missense	probably damaging	0.98
IGL02983:Dip2b	APN	15	100132022	missense	possibly damaging	0.81
IGL03120:Dip2b	APN	15	100203127	splice site	probably benign
IGL03181:Dip2b	APN	15	100215207	missense	probably damaging	0.98
IGL03229:Dip2b	APN	15	100207838	splice site	probably benign
IGL03399:Dip2b	APN	15	100175327	missense	possibly damaging	0.63
PIT4131001:Dip2b	UTSW	15	100202352	missense	probably damaging	1.00
R0009:Dip2b	UTSW	15	100169312	missense	probably damaging	1.00
R0058:Dip2b	UTSW	15	100215240	missense	probably benign	0.03
R0058:Dip2b	UTSW	15	100215240	missense	probably benign	0.03
R0092:Dip2b	UTSW	15	100202265	missense	probably damaging	1.00
R0201:Dip2b	UTSW	15	100186147	missense	probably damaging	0.98
R0359:Dip2b	UTSW	15	100211993	missense	probably damaging	0.98
R0390:Dip2b	UTSW	15	100193913	missense	probably damaging	0.99
R0564:Dip2b	UTSW	15	100162719	nonsense	probably null
R0730:Dip2b	UTSW	15	100171651	missense	probably damaging	1.00
R1144:Dip2b	UTSW	15	100154250	missense	probably benign	0.11
R1200:Dip2b	UTSW	15	100209745	missense	probably benign	0.00
R1506:Dip2b	UTSW	15	100183113	missense	probably damaging	1.00
R1750:Dip2b	UTSW	15	100178466	missense	probably benign
R1760:Dip2b	UTSW	15	100212029	missense	probably damaging	1.00
R1773:Dip2b	UTSW	15	100193961	missense	probably benign	0.00
R1812:Dip2b	UTSW	15	100198938	splice site	probably null
R2264:Dip2b	UTSW	15	100203216	missense	probably benign	0.05
R3105:Dip2b	UTSW	15	100142137	nonsense	probably null
R4029:Dip2b	UTSW	15	100186172	missense	probably damaging	1.00
R4030:Dip2b	UTSW	15	100186172	missense	probably damaging	1.00
R4296:Dip2b	UTSW	15	100181336	missense	probably benign
R4392:Dip2b	UTSW	15	100162036	missense	probably damaging	1.00
R4480:Dip2b	UTSW	15	100186301	missense	probably damaging	0.99
R4564:Dip2b	UTSW	15	100157258	nonsense	probably null
R4605:Dip2b	UTSW	15	100209636	missense	probably benign	0.00
R4606:Dip2b	UTSW	15	100215329	missense	possibly damaging	0.91
R4634:Dip2b	UTSW	15	100160491	missense	probably damaging	1.00
R4667:Dip2b	UTSW	15	100151360	missense	probably benign	0.01
R4739:Dip2b	UTSW	15	100207777	missense	probably damaging	0.98
R4826:Dip2b	UTSW	15	100169281	missense	probably damaging	0.99
R4870:Dip2b	UTSW	15	100195784	splice site	probably null
R4877:Dip2b	UTSW	15	100160529	missense	possibly damaging	0.49
R4932:Dip2b	UTSW	15	100171722	missense	probably damaging	1.00
R5009:Dip2b	UTSW	15	100195784	splice site	probably null
R5169:Dip2b	UTSW	15	100205113	missense	probably damaging	1.00
R5216:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5218:Dip2b	UTSW	15	100154296	missense	probably benign	0.00
R5274:Dip2b	UTSW	15	100212104	missense	possibly damaging	0.54
R5370:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5420:Dip2b	UTSW	15	100205173	intron	probably benign
R5447:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5670:Dip2b	UTSW	15	100190104	missense	possibly damaging	0.80
R5908:Dip2b	UTSW	15	100151184	missense	possibly damaging	0.93
R5957:Dip2b	UTSW	15	100209694	missense	probably benign	0.03
R5987:Dip2b	UTSW	15	100190079	missense	probably damaging	1.00
R6260:Dip2b	UTSW	15	100162702	missense	probably benign	0.05
R6325:Dip2b	UTSW	15	100154282	missense	probably benign	0.00
R6367:Dip2b	UTSW	15	100115914	missense	possibly damaging	0.50
R6391:Dip2b	UTSW	15	100151276	missense	probably damaging	1.00
R6422:Dip2b	UTSW	15	100199011	missense	probably damaging	0.98
R6818:Dip2b	UTSW	15	100193954	missense	probably benign	0.09
R6922:Dip2b	UTSW	15	100193843	missense	probably benign	0.25
R7002:Dip2b	UTSW	15	100160465	missense	probably benign	0.43
R7076:Dip2b	UTSW	15	100157972	splice site	probably null
R7176:Dip2b	UTSW	15	100169318	missense	probably damaging	1.00
R7255:Dip2b	UTSW	15	100209627	missense	probably benign	0.00
R7463:Dip2b	UTSW	15	100154157	missense	probably benign
R7513:Dip2b	UTSW	15	100207748	splice site	probably null
R7876:Dip2b	UTSW	15	100191041	missense	probably benign	0.02
R8368:Dip2b	UTSW	15	100154243	missense	probably benign	0.00
R9289:Dip2b	UTSW	15	100173271	missense	probably damaging	0.97
R9405:Dip2b	UTSW	15	100195876	missense	probably benign	0.05
R9477:Dip2b	UTSW	15	100038903	missense	probably damaging	1.00
R9485:Dip2b	UTSW	15	100155043	missense	probably benign	0.05
R9533:Dip2b	UTSW	15	100175297	missense	probably benign	0.06
R9581:Dip2b	UTSW	15	100181374	missense	probably damaging	0.99
R9666:Dip2b	UTSW	15	100209580	missense	probably damaging	1.00
X0064:Dip2b	UTSW	15	100115850	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAACTCAGCACAGCCGGTTG -3'
(R):5'- ACTGCTGTTGGAACTCTGTC -3'

Sequencing Primer
(F):5'- TGTGACAGCGAGCCTTTCAG -3'
(R):5'- CGACCATTTGTAACTCAAGGTCAGG -3'

Posted On

2016-11-21