Incidental Mutation 'R5768:Dip2b'
ID 446403
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 043368-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.636) question?
Stock # R5768 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 100055826 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 393 (P393T)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
AlphaFold Q3UH60
Predicted Effect probably benign
Transcript: ENSMUST00000023768
AA Change: P159T

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: P159T

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100203
AA Change: P393T

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: P393T

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108971
AA Change: P159T

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: P159T

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230733
Meta Mutation Damage Score 0.0900 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 G A 5: 8,177,426 (GRCm39) T561I probably benign Het
Akp3 T C 1: 87,054,844 (GRCm39) I393T probably damaging Het
Atxn10 A T 15: 85,277,621 (GRCm39) I363F probably benign Het
BC004004 A T 17: 29,501,709 (GRCm39) S83C probably damaging Het
Bin1 T A 18: 32,559,264 (GRCm39) probably null Het
Cacna1c A G 6: 118,674,641 (GRCm39) I541T probably damaging Het
Cand1 A G 10: 119,046,910 (GRCm39) V860A probably benign Het
Ccdc69 T C 11: 54,945,856 (GRCm39) N50S possibly damaging Het
Cd209d T A 8: 3,921,968 (GRCm39) T235S probably benign Het
Cdhr3 G T 12: 33,096,685 (GRCm39) T591K possibly damaging Het
Cherp C T 8: 73,216,957 (GRCm39) D658N probably damaging Het
Clip4 T A 17: 72,113,494 (GRCm39) probably null Het
Cryzl1 C T 16: 91,492,242 (GRCm39) V195M probably damaging Het
Cst11 A T 2: 148,612,387 (GRCm39) Y83* probably null Het
Ddb2 T C 2: 91,042,337 (GRCm39) S419G possibly damaging Het
Ddi2 A T 4: 141,412,901 (GRCm39) L4M probably damaging Het
Dnmt3a G A 12: 3,935,660 (GRCm39) probably null Het
Elf5 C T 2: 103,279,367 (GRCm39) S196L probably damaging Het
Eps15 C G 4: 109,220,373 (GRCm39) probably null Het
Fra10ac1 T C 19: 38,195,734 (GRCm39) E163G probably benign Het
Gc T C 5: 89,589,125 (GRCm39) T213A probably damaging Het
Grpel1 A T 5: 36,622,503 (GRCm39) probably benign Het
Gsdme G A 6: 50,196,280 (GRCm39) Q377* probably null Het
Hira T C 16: 18,753,768 (GRCm39) probably benign Het
Hsd11b1 T A 1: 192,922,554 (GRCm39) I168F probably damaging Het
Htr6 G A 4: 138,789,015 (GRCm39) R347W probably damaging Het
Ipp A C 4: 116,367,967 (GRCm39) T67P probably damaging Het
Lrfn5 G A 12: 61,886,509 (GRCm39) R99Q probably benign Het
Madd T A 2: 90,998,174 (GRCm39) I649F probably damaging Het
Map2k7 T A 8: 4,295,757 (GRCm39) D368E probably benign Het
Mppe1 T G 18: 67,358,889 (GRCm39) T360P possibly damaging Het
Msi2 A G 11: 88,608,564 (GRCm39) F2L probably damaging Het
Nectin3 T C 16: 46,279,180 (GRCm39) Q266R probably damaging Het
Nfasc T C 1: 132,532,883 (GRCm39) H691R probably benign Het
Oprm1 G A 10: 6,739,026 (GRCm39) G51D probably damaging Het
Or4c117 T C 2: 88,955,793 (GRCm39) E94G probably benign Het
Or5ac15 TGAAGAAGAA TGAAGAA 16: 58,940,335 (GRCm39) probably benign Het
Papss2 G A 19: 32,638,119 (GRCm39) probably null Het
Pi4ka T C 16: 17,172,736 (GRCm39) K549E probably benign Het
Plekha6 A G 1: 133,208,116 (GRCm39) T596A probably benign Het
Polr2f A G 15: 79,035,845 (GRCm39) D117G probably damaging Het
Psd T C 19: 46,301,178 (GRCm39) E381G possibly damaging Het
Rfx6 G A 10: 51,602,976 (GRCm39) R831H probably damaging Het
Rpp25l A T 4: 41,712,649 (GRCm39) L42Q probably damaging Het
Ryr3 T C 2: 112,583,442 (GRCm39) M2810V probably benign Het
Sdk1 C A 5: 142,129,626 (GRCm39) L1616I probably benign Het
Spock2 T A 10: 59,962,029 (GRCm39) F215I probably damaging Het
Susd2 C T 10: 75,473,853 (GRCm39) A581T probably damaging Het
Tchh A T 3: 93,353,488 (GRCm39) E976V unknown Het
Tgfbr3 T C 5: 107,297,761 (GRCm39) E213G probably benign Het
Tmed1 T C 9: 21,420,619 (GRCm39) D71G probably benign Het
Tmtc4 T A 14: 123,170,565 (GRCm39) K527N possibly damaging Het
Zfhx2 T C 14: 55,311,822 (GRCm39) T291A probably benign Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACTCAGCACAGCCGGTTG -3'
(R):5'- ACTGCTGTTGGAACTCTGTC -3'

Sequencing Primer
(F):5'- TGTGACAGCGAGCCTTTCAG -3'
(R):5'- CGACCATTTGTAACTCAAGGTCAGG -3'
Posted On 2016-11-21