Incidental Mutation 'R5768:Mppe1'
ID446407
Institutional Source Beutler Lab
Gene Symbol Mppe1
Ensembl Gene ENSMUSG00000062526
Gene Namemetallophosphoesterase 1
Synonyms
MMRRC Submission 043368-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5768 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location67225530-67245830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 67225818 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 360 (T360P)
Ref Sequence ENSEMBL: ENSMUSP00000072808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025402] [ENSMUST00000073054] [ENSMUST00000076605]
Predicted Effect probably benign
Transcript: ENSMUST00000025402
SMART Domains Protein: ENSMUSP00000025402
Gene: ENSMUSG00000024524

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
G_alpha 89 447 1.18e-172 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073054
AA Change: T360P

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072808
Gene: ENSMUSG00000062526
AA Change: T360P

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Metallophos 68 308 3.3e-13 PFAM
transmembrane domain 358 380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076605
SMART Domains Protein: ENSMUSP00000075908
Gene: ENSMUSG00000024524

DomainStartEndE-ValueType
G_alpha 22 380 5.02e-176 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 G A 5: 8,127,426 T561I probably benign Het
Akp3 T C 1: 87,127,122 I393T probably damaging Het
Atxn10 A T 15: 85,393,420 I363F probably benign Het
BC004004 A T 17: 29,282,735 S83C probably damaging Het
Bin1 T A 18: 32,426,211 probably null Het
Cacna1c A G 6: 118,697,680 I541T probably damaging Het
Cand1 A G 10: 119,211,005 V860A probably benign Het
Ccdc69 T C 11: 55,055,030 N50S possibly damaging Het
Cd209d T A 8: 3,871,968 T235S probably benign Het
Cdhr3 G T 12: 33,046,686 T591K possibly damaging Het
Cherp C T 8: 72,463,113 D658N probably damaging Het
Clip4 T A 17: 71,806,499 probably null Het
Cryzl1 C T 16: 91,695,354 V195M probably damaging Het
Cst11 A T 2: 148,770,467 Y83* probably null Het
Ddb2 T C 2: 91,211,992 S419G possibly damaging Het
Ddi2 A T 4: 141,685,590 L4M probably damaging Het
Dip2b C A 15: 100,157,945 P393T probably benign Het
Dnmt3a G A 12: 3,885,660 probably null Het
Elf5 C T 2: 103,449,022 S196L probably damaging Het
Eps15 C G 4: 109,363,176 probably null Het
Fra10ac1 T C 19: 38,207,286 E163G probably benign Het
Gc T C 5: 89,441,266 T213A probably damaging Het
Grpel1 A T 5: 36,465,159 probably benign Het
Gsdme G A 6: 50,219,300 Q377* probably null Het
Hira T C 16: 18,935,018 probably benign Het
Hsd11b1 T A 1: 193,240,246 I168F probably damaging Het
Htr6 G A 4: 139,061,704 R347W probably damaging Het
Ipp A C 4: 116,510,770 T67P probably damaging Het
Lrfn5 G A 12: 61,839,723 R99Q probably benign Het
Madd T A 2: 91,167,829 I649F probably damaging Het
Map2k7 T A 8: 4,245,757 D368E probably benign Het
Msi2 A G 11: 88,717,738 F2L probably damaging Het
Nectin3 T C 16: 46,458,817 Q266R probably damaging Het
Nfasc T C 1: 132,605,145 H691R probably benign Het
Olfr1222 T C 2: 89,125,449 E94G probably benign Het
Olfr194 TGAAGAAGAA TGAAGAA 16: 59,119,972 probably benign Het
Oprm1 G A 10: 6,789,026 G51D probably damaging Het
Papss2 G A 19: 32,660,719 probably null Het
Pi4ka T C 16: 17,354,872 K549E probably benign Het
Plekha6 A G 1: 133,280,378 T596A probably benign Het
Polr2f A G 15: 79,151,645 D117G probably damaging Het
Psd T C 19: 46,312,739 E381G possibly damaging Het
Rfx6 G A 10: 51,726,880 R831H probably damaging Het
Rpp25l A T 4: 41,712,649 L42Q probably damaging Het
Ryr3 T C 2: 112,753,097 M2810V probably benign Het
Sdk1 C A 5: 142,143,871 L1616I probably benign Het
Spock2 T A 10: 60,126,207 F215I probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tchh A T 3: 93,446,181 E976V unknown Het
Tgfbr3 T C 5: 107,149,895 E213G probably benign Het
Tmed1 T C 9: 21,509,323 D71G probably benign Het
Tmtc4 T A 14: 122,933,153 K527N possibly damaging Het
Zfhx2 T C 14: 55,074,365 T291A probably benign Het
Other mutations in Mppe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Mppe1 APN 18 67237444 nonsense probably null
IGL03028:Mppe1 APN 18 67227684 missense probably damaging 1.00
R0087:Mppe1 UTSW 18 67225704 makesense probably null
R0538:Mppe1 UTSW 18 67237477 missense probably damaging 1.00
R0552:Mppe1 UTSW 18 67237348 critical splice donor site probably null
R1170:Mppe1 UTSW 18 67227706 missense probably damaging 1.00
R1970:Mppe1 UTSW 18 67229772 missense probably benign 0.07
R2229:Mppe1 UTSW 18 67228011 critical splice donor site probably null
R3874:Mppe1 UTSW 18 67225886 critical splice acceptor site probably null
R4194:Mppe1 UTSW 18 67228068 missense probably benign 0.27
R4775:Mppe1 UTSW 18 67226859 missense possibly damaging 0.96
R4940:Mppe1 UTSW 18 67228024 missense probably damaging 1.00
R4974:Mppe1 UTSW 18 67228062 missense probably benign
R4979:Mppe1 UTSW 18 67229702 missense probably damaging 1.00
R5784:Mppe1 UTSW 18 67228027 missense probably benign 0.12
R5895:Mppe1 UTSW 18 67225763 missense probably benign 0.00
R6547:Mppe1 UTSW 18 67228988 missense probably benign
R7161:Mppe1 UTSW 18 67229771 missense probably benign 0.10
R7580:Mppe1 UTSW 18 67237417 missense probably damaging 0.99
R7699:Mppe1 UTSW 18 67225704 makesense probably null
R7700:Mppe1 UTSW 18 67225704 makesense probably null
R7908:Mppe1 UTSW 18 67228984 missense probably benign 0.01
R8399:Mppe1 UTSW 18 67225875 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATAGGAACAACCAGCATTTGC -3'
(R):5'- GTCGTGGGTAAAGAGGTCTC -3'

Sequencing Primer
(F):5'- CTCGCTGGAAGTCCTATAGGTC -3'
(R):5'- GAGGTCTCTTCCCTCCCAGAC -3'
Posted On2016-11-21