Incidental Mutation 'R5769:Coq8a'
ID446413
Institutional Source Beutler Lab
Gene Symbol Coq8a
Ensembl Gene ENSMUSG00000026489
Gene Namecoenzyme Q8A
Synonyms4632432J16Rik, Cabc1, Adck3
MMRRC Submission 043369-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R5769 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180165238-180199602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180179116 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 69 (Y69H)
Ref Sequence ENSEMBL: ENSMUSP00000124481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027766] [ENSMUST00000159914] [ENSMUST00000160102] [ENSMUST00000160121] [ENSMUST00000160169] [ENSMUST00000160482] [ENSMUST00000160879] [ENSMUST00000161300] [ENSMUST00000161379] [ENSMUST00000161632] [ENSMUST00000161743] [ENSMUST00000161746] [ENSMUST00000161814] [ENSMUST00000162725] [ENSMUST00000162769] [ENSMUST00000170472]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027766
AA Change: Y116H

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027766
Gene: ENSMUSG00000026489
AA Change: Y116H

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:ABC1 315 431 5.4e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159591
Predicted Effect probably benign
Transcript: ENSMUST00000159914
SMART Domains Protein: ENSMUSP00000123720
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160102
SMART Domains Protein: ENSMUSP00000124289
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160121
SMART Domains Protein: ENSMUSP00000124208
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160169
AA Change: Y116H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125089
Gene: ENSMUSG00000026489
AA Change: Y116H

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160482
AA Change: Y116H

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124329
Gene: ENSMUSG00000026489
AA Change: Y116H

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160879
SMART Domains Protein: ENSMUSP00000141948
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161300
SMART Domains Protein: ENSMUSP00000125002
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:ABC1 93 187 5.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161379
Predicted Effect probably damaging
Transcript: ENSMUST00000161632
AA Change: Y69H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124481
Gene: ENSMUSG00000026489
AA Change: Y69H

DomainStartEndE-ValueType
low complexity region 44 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161743
SMART Domains Protein: ENSMUSP00000123905
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161746
Predicted Effect probably damaging
Transcript: ENSMUST00000161814
AA Change: Y116H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125071
Gene: ENSMUSG00000026489
AA Change: Y116H

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162725
SMART Domains Protein: ENSMUSP00000125024
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162769
Predicted Effect possibly damaging
Transcript: ENSMUST00000170472
AA Change: Y116H

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128290
Gene: ENSMUSG00000026489
AA Change: Y116H

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:ABC1 315 431 5.1e-35 PFAM
Meta Mutation Damage Score 0.0694 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein similar to yeast ABC1, which functions in an electron-transferring membrane protein complex in the respiratory chain. It is not related to the family of ABC transporter proteins. Expression of this gene is induced by the tumor suppressor p53 and in response to DNA damage, and inhibiting its expression partially suppresses p53-induced apoptosis. Alternatively spliced transcript variants have been found; however, their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,333 V160E possibly damaging Het
Abcb1a A C 5: 8,683,426 E106A probably benign Het
Acap3 A T 4: 155,902,400 D371V probably damaging Het
Ahi1 T C 10: 20,960,082 probably null Het
Defb33 T A 8: 20,897,527 F27I possibly damaging Het
Dhx29 T A 13: 112,953,717 L776Q probably damaging Het
Dnah3 G A 7: 120,089,952 R80* probably null Het
Dtna A T 18: 23,651,554 D646V probably benign Het
Eml5 T A 12: 98,790,619 D1964V probably damaging Het
Fbn2 A T 18: 58,105,199 N575K probably damaging Het
Fbxo38 G A 18: 62,514,965 P834L probably benign Het
Fyb2 G T 4: 105,013,321 K706N probably damaging Het
Fyb2 T A 4: 105,015,644 V738E probably damaging Het
Gcm1 A G 9: 78,064,967 T397A probably benign Het
Gins1 A T 2: 150,925,998 E149D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12845 A C 4: 117,728,965 probably benign Het
Gm14124 A G 2: 150,268,278 E296G possibly damaging Het
Grin2a C T 16: 9,761,526 R291K possibly damaging Het
Hdac10 T C 15: 89,123,616 M646V probably benign Het
Hes6 G T 1: 91,412,949 R38S probably damaging Het
Hipk3 G A 2: 104,434,953 P667S possibly damaging Het
Jrk T C 15: 74,706,068 Q456R probably benign Het
Loxl3 A G 6: 83,050,600 T708A probably damaging Het
Lyg1 T C 1: 37,950,750 S19G unknown Het
Magel2 T A 7: 62,378,113 M255K probably benign Het
Mctp1 A G 13: 76,759,808 D242G probably damaging Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mms19 A G 19: 41,964,386 F95L probably damaging Het
Nav1 A G 1: 135,452,257 L1569P probably damaging Het
Nup188 A G 2: 30,330,735 E940G probably benign Het
Oas1d T C 5: 120,916,854 F163S probably benign Het
Odf2l A G 3: 145,135,731 K304R possibly damaging Het
Otud3 T A 4: 138,898,110 N211I possibly damaging Het
Pabpc6 A T 17: 9,667,843 L593* probably null Het
Pdcd11 T A 19: 47,102,637 L350Q possibly damaging Het
Pdia4 A G 6: 47,815,512 probably benign Het
Pik3cb G A 9: 99,093,159 Q223* probably null Het
Plb1 G A 5: 32,317,522 V696M probably benign Het
Ppp2r5a T C 1: 191,372,666 D61G probably benign Het
Preb G T 5: 30,958,291 Y87* probably null Het
Rdh16f2 A T 10: 127,876,889 N252I probably benign Het
Rida T C 15: 34,484,558 probably benign Het
Rxrb T C 17: 34,032,847 probably benign Het
Sis T A 3: 72,928,235 K931N probably damaging Het
Srcap T A 7: 127,559,822 probably benign Het
Srp68 A G 11: 116,246,669 S525P probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Synj1 A G 16: 90,938,253 probably benign Het
Syt12 T C 19: 4,451,044 Y326C probably damaging Het
Tesk2 A G 4: 116,802,315 probably null Het
Tmem41b G A 7: 109,978,738 T113I possibly damaging Het
Tmtc2 T C 10: 105,370,046 I463V probably benign Het
Trak1 A T 9: 121,448,838 D320V probably damaging Het
Ushbp1 A T 8: 71,386,219 N570K probably benign Het
Vmn1r33 T A 6: 66,611,833 I246F possibly damaging Het
Vmn2r54 A C 7: 12,615,282 L791R possibly damaging Het
Washc1 A T 17: 66,118,116 T372S probably benign Het
Other mutations in Coq8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Coq8a APN 1 180168389 missense probably benign 0.11
IGL01797:Coq8a APN 1 180169719 splice site probably null
IGL01873:Coq8a APN 1 180178977 missense probably damaging 1.00
R1148:Coq8a UTSW 1 180169403 splice site probably benign
R1421:Coq8a UTSW 1 180170441 splice site probably benign
R1743:Coq8a UTSW 1 180182229 missense probably benign 0.14
R4678:Coq8a UTSW 1 180170081 missense probably damaging 0.99
R4827:Coq8a UTSW 1 180167338 missense possibly damaging 0.46
R4904:Coq8a UTSW 1 180178603 missense probably damaging 1.00
R5716:Coq8a UTSW 1 180179260 missense possibly damaging 0.94
R6636:Coq8a UTSW 1 180178987 missense probably benign 0.00
R6991:Coq8a UTSW 1 180179068 missense probably benign 0.00
R7125:Coq8a UTSW 1 180168801 missense probably damaging 1.00
R7158:Coq8a UTSW 1 180179184 missense probably benign 0.00
R7161:Coq8a UTSW 1 180170341 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCAATGTCTTCAGCCGTGAG -3'
(R):5'- GGGCAGTCACATGCAAGTAC -3'

Sequencing Primer
(F):5'- CGTGAGGCCTCCCACGG -3'
(R):5'- GTCACATGCAAGTACCTCACCAG -3'
Posted On2016-11-21