Incidental Mutation 'R5769:Acap3'
ID446426
Institutional Source Beutler Lab
Gene Symbol Acap3
Ensembl Gene ENSMUSG00000029033
Gene NameArfGAP with coiled-coil, ankyrin repeat and PH domains 3
SynonymsCentb5, Kiaa1716-hp
MMRRC Submission 043369-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R5769 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155891822-155907251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155902400 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 371 (D371V)
Ref Sequence ENSEMBL: ENSMUSP00000101209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079031] [ENSMUST00000105584]
Predicted Effect probably damaging
Transcript: ENSMUST00000079031
AA Change: D367V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078040
Gene: ENSMUSG00000029033
AA Change: D367V

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
PH 265 361 6.35e-16 SMART
low complexity region 377 391 N/A INTRINSIC
ArfGap 399 521 4.62e-56 SMART
low complexity region 554 566 N/A INTRINSIC
low complexity region 601 617 N/A INTRINSIC
low complexity region 628 650 N/A INTRINSIC
low complexity region 669 686 N/A INTRINSIC
ANK 696 725 3.91e-3 SMART
ANK 729 758 2.43e1 SMART
low complexity region 781 796 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105584
AA Change: D371V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101209
Gene: ENSMUSG00000029033
AA Change: D371V

DomainStartEndE-ValueType
Pfam:BAR_3 3 236 4.1e-95 PFAM
PH 269 365 6.35e-16 SMART
low complexity region 381 395 N/A INTRINSIC
ArfGap 403 525 4.62e-56 SMART
low complexity region 558 570 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 673 690 N/A INTRINSIC
ANK 700 729 3.91e-3 SMART
ANK 733 762 2.43e1 SMART
low complexity region 785 800 N/A INTRINSIC
low complexity region 801 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145654
Meta Mutation Damage Score 0.1121 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,333 V160E possibly damaging Het
Abcb1a A C 5: 8,683,426 E106A probably benign Het
Ahi1 T C 10: 20,960,082 probably null Het
Coq8a A G 1: 180,179,116 Y69H probably damaging Het
Defb33 T A 8: 20,897,527 F27I possibly damaging Het
Dhx29 T A 13: 112,953,717 L776Q probably damaging Het
Dnah3 G A 7: 120,089,952 R80* probably null Het
Dtna A T 18: 23,651,554 D646V probably benign Het
Eml5 T A 12: 98,790,619 D1964V probably damaging Het
Fbn2 A T 18: 58,105,199 N575K probably damaging Het
Fbxo38 G A 18: 62,514,965 P834L probably benign Het
Fyb2 G T 4: 105,013,321 K706N probably damaging Het
Fyb2 T A 4: 105,015,644 V738E probably damaging Het
Gcm1 A G 9: 78,064,967 T397A probably benign Het
Gins1 A T 2: 150,925,998 E149D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12845 A C 4: 117,728,965 probably benign Het
Gm14124 A G 2: 150,268,278 E296G possibly damaging Het
Grin2a C T 16: 9,761,526 R291K possibly damaging Het
Hdac10 T C 15: 89,123,616 M646V probably benign Het
Hes6 G T 1: 91,412,949 R38S probably damaging Het
Hipk3 G A 2: 104,434,953 P667S possibly damaging Het
Jrk T C 15: 74,706,068 Q456R probably benign Het
Loxl3 A G 6: 83,050,600 T708A probably damaging Het
Lyg1 T C 1: 37,950,750 S19G unknown Het
Magel2 T A 7: 62,378,113 M255K probably benign Het
Mctp1 A G 13: 76,759,808 D242G probably damaging Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mms19 A G 19: 41,964,386 F95L probably damaging Het
Nav1 A G 1: 135,452,257 L1569P probably damaging Het
Nup188 A G 2: 30,330,735 E940G probably benign Het
Oas1d T C 5: 120,916,854 F163S probably benign Het
Odf2l A G 3: 145,135,731 K304R possibly damaging Het
Otud3 T A 4: 138,898,110 N211I possibly damaging Het
Pabpc6 A T 17: 9,667,843 L593* probably null Het
Pdcd11 T A 19: 47,102,637 L350Q possibly damaging Het
Pdia4 A G 6: 47,815,512 probably benign Het
Pik3cb G A 9: 99,093,159 Q223* probably null Het
Plb1 G A 5: 32,317,522 V696M probably benign Het
Ppp2r5a T C 1: 191,372,666 D61G probably benign Het
Preb G T 5: 30,958,291 Y87* probably null Het
Rdh16f2 A T 10: 127,876,889 N252I probably benign Het
Rida T C 15: 34,484,558 probably benign Het
Rxrb T C 17: 34,032,847 probably benign Het
Sis T A 3: 72,928,235 K931N probably damaging Het
Srcap T A 7: 127,559,822 probably benign Het
Srp68 A G 11: 116,246,669 S525P probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Synj1 A G 16: 90,938,253 probably benign Het
Syt12 T C 19: 4,451,044 Y326C probably damaging Het
Tesk2 A G 4: 116,802,315 probably null Het
Tmem41b G A 7: 109,978,738 T113I possibly damaging Het
Tmtc2 T C 10: 105,370,046 I463V probably benign Het
Trak1 A T 9: 121,448,838 D320V probably damaging Het
Ushbp1 A T 8: 71,386,219 N570K probably benign Het
Vmn1r33 T A 6: 66,611,833 I246F possibly damaging Het
Vmn2r54 A C 7: 12,615,282 L791R possibly damaging Het
Washc1 A T 17: 66,118,116 T372S probably benign Het
Other mutations in Acap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Acap3 APN 4 155902219 missense probably damaging 0.99
IGL01815:Acap3 APN 4 155902187 missense probably damaging 1.00
IGL02104:Acap3 APN 4 155905085 missense probably damaging 1.00
IGL02387:Acap3 APN 4 155902160 missense probably damaging 1.00
IGL02544:Acap3 APN 4 155892410 missense possibly damaging 0.93
IGL03124:Acap3 APN 4 155905033 missense probably benign 0.00
IGL03052:Acap3 UTSW 4 155903358 missense probably damaging 1.00
PIT4514001:Acap3 UTSW 4 155903378 missense probably benign 0.00
R0207:Acap3 UTSW 4 155899424 missense probably damaging 1.00
R0452:Acap3 UTSW 4 155902328 nonsense probably null
R1110:Acap3 UTSW 4 155905399 splice site probably null
R1387:Acap3 UTSW 4 155899480 missense probably benign 0.06
R1475:Acap3 UTSW 4 155902821 missense probably damaging 1.00
R1535:Acap3 UTSW 4 155896174 splice site probably benign
R2136:Acap3 UTSW 4 155896912 missense probably damaging 1.00
R2149:Acap3 UTSW 4 155905625 missense probably damaging 1.00
R2218:Acap3 UTSW 4 155903862 splice site probably null
R2897:Acap3 UTSW 4 155904931 splice site probably null
R2898:Acap3 UTSW 4 155903459 missense possibly damaging 0.88
R2898:Acap3 UTSW 4 155904931 splice site probably null
R3008:Acap3 UTSW 4 155905682 missense probably benign 0.37
R4170:Acap3 UTSW 4 155900001 missense possibly damaging 0.85
R4193:Acap3 UTSW 4 155901777 missense probably benign 0.07
R4822:Acap3 UTSW 4 155902451 intron probably benign
R4882:Acap3 UTSW 4 155905655 missense probably damaging 0.99
R5482:Acap3 UTSW 4 155900156 missense probably benign 0.00
R5655:Acap3 UTSW 4 155896619 missense probably benign 0.22
R5943:Acap3 UTSW 4 155899422 missense possibly damaging 0.78
R6236:Acap3 UTSW 4 155905207 missense possibly damaging 0.91
R6259:Acap3 UTSW 4 155896118 missense possibly damaging 0.91
R6790:Acap3 UTSW 4 155902991 missense probably damaging 1.00
R7000:Acap3 UTSW 4 155903849 missense possibly damaging 0.79
R7352:Acap3 UTSW 4 155905711 missense possibly damaging 0.56
R7442:Acap3 UTSW 4 155905621 missense probably damaging 0.98
RF008:Acap3 UTSW 4 155905098 small insertion probably benign
RF010:Acap3 UTSW 4 155905096 small insertion probably benign
RF013:Acap3 UTSW 4 155905096 small insertion probably benign
RF022:Acap3 UTSW 4 155905096 small insertion probably benign
RF025:Acap3 UTSW 4 155905102 small insertion probably benign
RF028:Acap3 UTSW 4 155905091 small insertion probably benign
RF032:Acap3 UTSW 4 155905102 small insertion probably benign
RF034:Acap3 UTSW 4 155905092 small insertion probably benign
RF035:Acap3 UTSW 4 155905091 small insertion probably benign
RF036:Acap3 UTSW 4 155905087 small insertion probably benign
RF038:Acap3 UTSW 4 155905092 small insertion probably benign
RF039:Acap3 UTSW 4 155905092 small insertion probably benign
RF041:Acap3 UTSW 4 155905100 small insertion probably benign
RF064:Acap3 UTSW 4 155905100 small insertion probably benign
Z1176:Acap3 UTSW 4 155905179 missense probably damaging 1.00
Z1177:Acap3 UTSW 4 155905518 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCTACCAAGTGAGGAGG -3'
(R):5'- AGGAGCTTGTCTCAACTCCC -3'

Sequencing Primer
(F):5'- CTACCAAGTGAGGAGGCCCAG -3'
(R):5'- CCCAGTTAGAAGGGTCAGCAC -3'
Posted On2016-11-21