Incidental Mutation 'R5769:Preb'
ID446428
Institutional Source Beutler Lab
Gene Symbol Preb
Ensembl Gene ENSMUSG00000045302
Gene Nameprolactin regulatory element binding
Synonyms
MMRRC Submission 043369-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R5769 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30950853-30960361 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 30958291 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 87 (Y87*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074840] [ENSMUST00000202567]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000006814
SMART Domains Protein: ENSMUSP00000143649
Gene: ENSMUSG00000006638

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Hydrolase_4 127 371 1.3e-9 PFAM
Pfam:Abhydrolase_1 131 373 1.4e-12 PFAM
Pfam:Abhydrolase_5 132 367 2.8e-8 PFAM
Pfam:Abhydrolase_6 133 377 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074840
AA Change: Q232K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074387
Gene: ENSMUSG00000045302
AA Change: Q232K

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 99 114 N/A INTRINSIC
WD40 143 182 4.48e-2 SMART
WD40 185 223 4.88e-3 SMART
WD40 289 328 4.42e1 SMART
Blast:WD40 332 382 5e-26 BLAST
transmembrane domain 391 413 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000125524
AA Change: Y162*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135863
AA Change: Q87K
Predicted Effect probably null
Transcript: ENSMUST00000156351
AA Change: Y87*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200836
Predicted Effect unknown
Transcript: ENSMUST00000201002
AA Change: Q58K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201730
Predicted Effect probably benign
Transcript: ENSMUST00000201821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202472
Predicted Effect probably benign
Transcript: ENSMUST00000202567
AA Change: Q232K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144263
Gene: ENSMUSG00000045302
AA Change: Q232K

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 99 114 N/A INTRINSIC
WD40 143 182 4.48e-2 SMART
WD40 185 223 4.88e-3 SMART
WD40 289 328 4.42e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202930
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that specifically binds to a Pit1-binding element of the prolactin (PRL) promoter. This protein may act as a transcriptional regulator and is thought to be involved in some of the developmental abnormalities observed in patients with partial trisomy 2p. This gene overlaps the abhydrolase domain containing 1 (ABHD1) gene on the opposite strand. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,333 V160E possibly damaging Het
Abcb1a A C 5: 8,683,426 E106A probably benign Het
Acap3 A T 4: 155,902,400 D371V probably damaging Het
Ahi1 T C 10: 20,960,082 probably null Het
Coq8a A G 1: 180,179,116 Y69H probably damaging Het
Defb33 T A 8: 20,897,527 F27I possibly damaging Het
Dhx29 T A 13: 112,953,717 L776Q probably damaging Het
Dnah3 G A 7: 120,089,952 R80* probably null Het
Dtna A T 18: 23,651,554 D646V probably benign Het
Eml5 T A 12: 98,790,619 D1964V probably damaging Het
Fbn2 A T 18: 58,105,199 N575K probably damaging Het
Fbxo38 G A 18: 62,514,965 P834L probably benign Het
Fyb2 G T 4: 105,013,321 K706N probably damaging Het
Fyb2 T A 4: 105,015,644 V738E probably damaging Het
Gcm1 A G 9: 78,064,967 T397A probably benign Het
Gins1 A T 2: 150,925,998 E149D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12845 A C 4: 117,728,965 probably benign Het
Gm14124 A G 2: 150,268,278 E296G possibly damaging Het
Grin2a C T 16: 9,761,526 R291K possibly damaging Het
Hdac10 T C 15: 89,123,616 M646V probably benign Het
Hes6 G T 1: 91,412,949 R38S probably damaging Het
Hipk3 G A 2: 104,434,953 P667S possibly damaging Het
Jrk T C 15: 74,706,068 Q456R probably benign Het
Loxl3 A G 6: 83,050,600 T708A probably damaging Het
Lyg1 T C 1: 37,950,750 S19G unknown Het
Magel2 T A 7: 62,378,113 M255K probably benign Het
Mctp1 A G 13: 76,759,808 D242G probably damaging Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mms19 A G 19: 41,964,386 F95L probably damaging Het
Nav1 A G 1: 135,452,257 L1569P probably damaging Het
Nup188 A G 2: 30,330,735 E940G probably benign Het
Oas1d T C 5: 120,916,854 F163S probably benign Het
Odf2l A G 3: 145,135,731 K304R possibly damaging Het
Otud3 T A 4: 138,898,110 N211I possibly damaging Het
Pabpc6 A T 17: 9,667,843 L593* probably null Het
Pdcd11 T A 19: 47,102,637 L350Q possibly damaging Het
Pdia4 A G 6: 47,815,512 probably benign Het
Pik3cb G A 9: 99,093,159 Q223* probably null Het
Plb1 G A 5: 32,317,522 V696M probably benign Het
Ppp2r5a T C 1: 191,372,666 D61G probably benign Het
Rdh16f2 A T 10: 127,876,889 N252I probably benign Het
Rida T C 15: 34,484,558 probably benign Het
Rxrb T C 17: 34,032,847 probably benign Het
Sis T A 3: 72,928,235 K931N probably damaging Het
Srcap T A 7: 127,559,822 probably benign Het
Srp68 A G 11: 116,246,669 S525P probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Synj1 A G 16: 90,938,253 probably benign Het
Syt12 T C 19: 4,451,044 Y326C probably damaging Het
Tesk2 A G 4: 116,802,315 probably null Het
Tmem41b G A 7: 109,978,738 T113I possibly damaging Het
Tmtc2 T C 10: 105,370,046 I463V probably benign Het
Trak1 A T 9: 121,448,838 D320V probably damaging Het
Ushbp1 A T 8: 71,386,219 N570K probably benign Het
Vmn1r33 T A 6: 66,611,833 I246F possibly damaging Het
Vmn2r54 A C 7: 12,615,282 L791R possibly damaging Het
Washc1 A T 17: 66,118,116 T372S probably benign Het
Other mutations in Preb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Preb APN 5 30955964 missense probably damaging 1.00
IGL01344:Preb APN 5 30956044 missense probably damaging 0.99
IGL03383:Preb APN 5 30958321 missense probably damaging 1.00
R1520:Preb UTSW 5 30958524 missense probably benign 0.14
R1987:Preb UTSW 5 30958813 missense probably damaging 1.00
R2327:Preb UTSW 5 30958505 missense probably damaging 0.99
R5607:Preb UTSW 5 30959963 splice site probably benign
R5831:Preb UTSW 5 30958864 missense probably benign
R6271:Preb UTSW 5 30958051 missense probably damaging 0.99
R6539:Preb UTSW 5 30956076 missense probably benign 0.03
R7575:Preb UTSW 5 30958495 missense probably damaging 1.00
R7873:Preb UTSW 5 30958765 missense probably benign 0.05
R7956:Preb UTSW 5 30958765 missense probably benign 0.05
X0065:Preb UTSW 5 30958936 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTCCTGTCAGCCCTCATG -3'
(R):5'- GGTCCTGATGGCAAGGTAAG -3'

Sequencing Primer
(F):5'- GTCAGCCCTCATGTTTGTGC -3'
(R):5'- CCTGATGGCAAGGTAAGGAGGTG -3'
Posted On2016-11-21