Incidental Mutation 'R5769:Pdia4'
ID446433
Institutional Source Beutler Lab
Gene Symbol Pdia4
Ensembl Gene ENSMUSG00000025823
Gene Nameprotein disulfide isomerase associated 4
SynonymsCai, U48620, Erp72, ERp72
MMRRC Submission 043369-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5769 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location47796141-47813430 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 47815512 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058844] [ENSMUST00000077290]
Predicted Effect probably benign
Transcript: ENSMUST00000058844
SMART Domains Protein: ENSMUSP00000057495
Gene: ENSMUSG00000051499

DomainStartEndE-ValueType
KRAB 9 69 2.6e-22 SMART
low complexity region 156 164 N/A INTRINSIC
ZnF_C2H2 240 262 5.34e-1 SMART
ZnF_C2H2 268 295 1.41e2 SMART
ZnF_C2H2 420 440 1.21e2 SMART
ZnF_C2H2 448 470 3.52e-1 SMART
ZnF_C2H2 476 498 1.89e-1 SMART
ZnF_C2H2 504 526 1.69e-3 SMART
ZnF_C2H2 532 554 5.59e-4 SMART
ZnF_C2H2 560 582 4.79e-3 SMART
ZnF_C2H2 588 610 3.69e-4 SMART
ZnF_C2H2 616 638 3.63e-3 SMART
ZnF_C2H2 644 665 5.92e0 SMART
ZnF_C2H2 671 693 2.57e-3 SMART
ZnF_C2H2 699 721 1.38e-3 SMART
ZnF_C2H2 727 749 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077290
SMART Domains Protein: ENSMUSP00000076521
Gene: ENSMUSG00000025823

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 29 57 N/A INTRINSIC
Pfam:Thioredoxin 59 163 4.1e-34 PFAM
Pfam:Calsequestrin 165 388 5.2e-13 PFAM
Pfam:Thioredoxin 174 278 3e-34 PFAM
Pfam:Thioredoxin_6 308 500 5.9e-21 PFAM
Pfam:Thioredoxin 522 630 5e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000080603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204029
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, three catalytically active thioredoxin (TRX) domains, two TRX-like domains and a C-terminal ER-retention sequence. This protein, when bound to cyclophilin B, enhances the rate of immunoglobulin G intermolecular disulfide bonding and antibody assembly. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in platelets exhibit decreased platelet aggregation and increased bleeding time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,333 V160E possibly damaging Het
Abcb1a A C 5: 8,683,426 E106A probably benign Het
Acap3 A T 4: 155,902,400 D371V probably damaging Het
Ahi1 T C 10: 20,960,082 probably null Het
Coq8a A G 1: 180,179,116 Y69H probably damaging Het
Defb33 T A 8: 20,897,527 F27I possibly damaging Het
Dhx29 T A 13: 112,953,717 L776Q probably damaging Het
Dnah3 G A 7: 120,089,952 R80* probably null Het
Dtna A T 18: 23,651,554 D646V probably benign Het
Eml5 T A 12: 98,790,619 D1964V probably damaging Het
Fbn2 A T 18: 58,105,199 N575K probably damaging Het
Fbxo38 G A 18: 62,514,965 P834L probably benign Het
Fyb2 G T 4: 105,013,321 K706N probably damaging Het
Fyb2 T A 4: 105,015,644 V738E probably damaging Het
Gcm1 A G 9: 78,064,967 T397A probably benign Het
Gins1 A T 2: 150,925,998 E149D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12845 A C 4: 117,728,965 probably benign Het
Gm14124 A G 2: 150,268,278 E296G possibly damaging Het
Grin2a C T 16: 9,761,526 R291K possibly damaging Het
Hdac10 T C 15: 89,123,616 M646V probably benign Het
Hes6 G T 1: 91,412,949 R38S probably damaging Het
Hipk3 G A 2: 104,434,953 P667S possibly damaging Het
Jrk T C 15: 74,706,068 Q456R probably benign Het
Loxl3 A G 6: 83,050,600 T708A probably damaging Het
Lyg1 T C 1: 37,950,750 S19G unknown Het
Magel2 T A 7: 62,378,113 M255K probably benign Het
Mctp1 A G 13: 76,759,808 D242G probably damaging Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mms19 A G 19: 41,964,386 F95L probably damaging Het
Nav1 A G 1: 135,452,257 L1569P probably damaging Het
Nup188 A G 2: 30,330,735 E940G probably benign Het
Oas1d T C 5: 120,916,854 F163S probably benign Het
Odf2l A G 3: 145,135,731 K304R possibly damaging Het
Otud3 T A 4: 138,898,110 N211I possibly damaging Het
Pabpc6 A T 17: 9,667,843 L593* probably null Het
Pdcd11 T A 19: 47,102,637 L350Q possibly damaging Het
Pik3cb G A 9: 99,093,159 Q223* probably null Het
Plb1 G A 5: 32,317,522 V696M probably benign Het
Ppp2r5a T C 1: 191,372,666 D61G probably benign Het
Preb G T 5: 30,958,291 Y87* probably null Het
Rdh16f2 A T 10: 127,876,889 N252I probably benign Het
Rida T C 15: 34,484,558 probably benign Het
Rxrb T C 17: 34,032,847 probably benign Het
Sis T A 3: 72,928,235 K931N probably damaging Het
Srcap T A 7: 127,559,822 probably benign Het
Srp68 A G 11: 116,246,669 S525P probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Synj1 A G 16: 90,938,253 probably benign Het
Syt12 T C 19: 4,451,044 Y326C probably damaging Het
Tesk2 A G 4: 116,802,315 probably null Het
Tmem41b G A 7: 109,978,738 T113I possibly damaging Het
Tmtc2 T C 10: 105,370,046 I463V probably benign Het
Trak1 A T 9: 121,448,838 D320V probably damaging Het
Ushbp1 A T 8: 71,386,219 N570K probably benign Het
Vmn1r33 T A 6: 66,611,833 I246F possibly damaging Het
Vmn2r54 A C 7: 12,615,282 L791R possibly damaging Het
Washc1 A T 17: 66,118,116 T372S probably benign Het
Other mutations in Pdia4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01882:Pdia4 APN 6 47803478 missense probably benign 0.25
IGL02207:Pdia4 APN 6 47796807 missense probably benign 0.01
IGL02456:Pdia4 APN 6 47803495 missense probably benign 0.19
R0078:Pdia4 UTSW 6 47798410 missense possibly damaging 0.51
R0501:Pdia4 UTSW 6 47801002 missense probably damaging 1.00
R0622:Pdia4 UTSW 6 47806518 missense probably damaging 1.00
R1243:Pdia4 UTSW 6 47807120 missense probably damaging 1.00
R1635:Pdia4 UTSW 6 47799199 missense possibly damaging 0.85
R1830:Pdia4 UTSW 6 47796761 nonsense probably null
R1853:Pdia4 UTSW 6 47813227 missense unknown
R1854:Pdia4 UTSW 6 47813227 missense unknown
R1951:Pdia4 UTSW 6 47803879 missense probably damaging 1.00
R1990:Pdia4 UTSW 6 47796655 missense probably benign
R2126:Pdia4 UTSW 6 47796837 missense probably damaging 1.00
R2163:Pdia4 UTSW 6 47798407 missense possibly damaging 0.77
R2351:Pdia4 UTSW 6 47796914 splice site probably null
R2415:Pdia4 UTSW 6 47806556 missense probably benign 0.27
R4375:Pdia4 UTSW 6 47798392 missense probably damaging 1.00
R4376:Pdia4 UTSW 6 47798392 missense probably damaging 1.00
R4377:Pdia4 UTSW 6 47798392 missense probably damaging 1.00
R5132:Pdia4 UTSW 6 47796735 missense probably benign 0.01
R5250:Pdia4 UTSW 6 47796685 missense possibly damaging 0.55
R5339:Pdia4 UTSW 6 47796685 missense possibly damaging 0.55
R5432:Pdia4 UTSW 6 47798466 missense possibly damaging 0.89
R5541:Pdia4 UTSW 6 47796637 missense probably damaging 1.00
R5873:Pdia4 UTSW 6 47808176 missense probably damaging 1.00
R6340:Pdia4 UTSW 6 47801018 missense probably benign 0.43
R7187:Pdia4 UTSW 6 47813259 missense unknown
R7231:Pdia4 UTSW 6 47800957 missense probably benign
R7791:Pdia4 UTSW 6 47807122 missense probably damaging 1.00
RF033:Pdia4 UTSW 6 47808288 small deletion probably benign
RF042:Pdia4 UTSW 6 47808306 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGGTGCTCTAGACTCTCAC -3'
(R):5'- CATCTTGGCACCTGTGGAG -3'

Sequencing Primer
(F):5'- AGCATCACACGGATTCTGTG -3'
(R):5'- TGGAGGCCTGCTGGGAAC -3'
Posted On2016-11-21