Incidental Mutation 'R5769:Loxl3'
ID446435
Institutional Source Beutler Lab
Gene Symbol Loxl3
Ensembl Gene ENSMUSG00000000693
Gene Namelysyl oxidase-like 3
SynonymsLor2
MMRRC Submission 043369-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R5769 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83034173-83052562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83050600 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 708 (T708A)
Ref Sequence ENSEMBL: ENSMUSP00000000707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000707] [ENSMUST00000089645] [ENSMUST00000092618] [ENSMUST00000101257] [ENSMUST00000113962] [ENSMUST00000113963] [ENSMUST00000122955] [ENSMUST00000134606]
Predicted Effect probably damaging
Transcript: ENSMUST00000000707
AA Change: T708A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000707
Gene: ENSMUSG00000000693
AA Change: T708A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 408 3.72e-51 SMART
SR 418 526 8.5e-37 SMART
Pfam:Lysyl_oxidase 530 730 3.9e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089645
SMART Domains Protein: ENSMUSP00000087073
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 341 1.1e-14 PFAM
Pfam:Trypsin_2 182 320 1.2e-34 PFAM
PDZ 371 445 2.86e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092618
SMART Domains Protein: ENSMUSP00000090281
Gene: ENSMUSG00000068328

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
PlsC 119 222 1.04e-1 SMART
low complexity region 307 322 N/A INTRINSIC
CUE 325 366 1.3e-9 SMART
low complexity region 378 392 N/A INTRINSIC
low complexity region 421 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101257
AA Change: T426A

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098815
Gene: ENSMUSG00000000693
AA Change: T426A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 396 5.46e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113962
SMART Domains Protein: ENSMUSP00000109595
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin_2 182 237 2.7e-12 PFAM
Pfam:Trypsin 212 277 4.5e-6 PFAM
PDZ 285 348 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113963
SMART Domains Protein: ENSMUSP00000109596
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 342 6.8e-15 PFAM
Pfam:Trypsin_2 182 320 7.1e-24 PFAM
PDZ 350 413 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122955
SMART Domains Protein: ENSMUSP00000138153
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 321 2.1e-10 PFAM
Pfam:Trypsin_2 182 317 9.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132099
Predicted Effect probably benign
Transcript: ENSMUST00000134606
SMART Domains Protein: ENSMUSP00000115547
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
Pfam:Trypsin 7 180 2.7e-15 PFAM
Pfam:Trypsin_2 20 158 3.1e-24 PFAM
PDZ 209 283 2.86e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144058
Predicted Effect probably benign
Transcript: ENSMUST00000150217
SMART Domains Protein: ENSMUSP00000118234
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Trypsin 41 215 1.6e-11 PFAM
Pfam:Trypsin_2 53 190 1.8e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204385
Predicted Effect probably benign
Transcript: ENSMUST00000204719
Predicted Effect probably benign
Transcript: ENSMUST00000203915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204895
Predicted Effect probably benign
Transcript: ENSMUST00000204343
Meta Mutation Damage Score 0.1275 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysyl oxidase, which likely functions as an amine oxidase and plays a role in the formation of crosslinks in collagens and elastin. Deletion of the related gene in mouse causes neonatal mortality with cleft palate, spine deformity, and defects in collagen organization. A mutation in this gene was found in a family with Stickler syndrome. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality shortly after birth, craniofacial and vertebral abnormalities associated with collagen deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,333 V160E possibly damaging Het
Abcb1a A C 5: 8,683,426 E106A probably benign Het
Acap3 A T 4: 155,902,400 D371V probably damaging Het
Ahi1 T C 10: 20,960,082 probably null Het
Coq8a A G 1: 180,179,116 Y69H probably damaging Het
Defb33 T A 8: 20,897,527 F27I possibly damaging Het
Dhx29 T A 13: 112,953,717 L776Q probably damaging Het
Dnah3 G A 7: 120,089,952 R80* probably null Het
Dtna A T 18: 23,651,554 D646V probably benign Het
Eml5 T A 12: 98,790,619 D1964V probably damaging Het
Fbn2 A T 18: 58,105,199 N575K probably damaging Het
Fbxo38 G A 18: 62,514,965 P834L probably benign Het
Fyb2 G T 4: 105,013,321 K706N probably damaging Het
Fyb2 T A 4: 105,015,644 V738E probably damaging Het
Gcm1 A G 9: 78,064,967 T397A probably benign Het
Gins1 A T 2: 150,925,998 E149D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12845 A C 4: 117,728,965 probably benign Het
Gm14124 A G 2: 150,268,278 E296G possibly damaging Het
Grin2a C T 16: 9,761,526 R291K possibly damaging Het
Hdac10 T C 15: 89,123,616 M646V probably benign Het
Hes6 G T 1: 91,412,949 R38S probably damaging Het
Hipk3 G A 2: 104,434,953 P667S possibly damaging Het
Jrk T C 15: 74,706,068 Q456R probably benign Het
Lyg1 T C 1: 37,950,750 S19G unknown Het
Magel2 T A 7: 62,378,113 M255K probably benign Het
Mctp1 A G 13: 76,759,808 D242G probably damaging Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mms19 A G 19: 41,964,386 F95L probably damaging Het
Nav1 A G 1: 135,452,257 L1569P probably damaging Het
Nup188 A G 2: 30,330,735 E940G probably benign Het
Oas1d T C 5: 120,916,854 F163S probably benign Het
Odf2l A G 3: 145,135,731 K304R possibly damaging Het
Otud3 T A 4: 138,898,110 N211I possibly damaging Het
Pabpc6 A T 17: 9,667,843 L593* probably null Het
Pdcd11 T A 19: 47,102,637 L350Q possibly damaging Het
Pdia4 A G 6: 47,815,512 probably benign Het
Pik3cb G A 9: 99,093,159 Q223* probably null Het
Plb1 G A 5: 32,317,522 V696M probably benign Het
Ppp2r5a T C 1: 191,372,666 D61G probably benign Het
Preb G T 5: 30,958,291 Y87* probably null Het
Rdh16f2 A T 10: 127,876,889 N252I probably benign Het
Rida T C 15: 34,484,558 probably benign Het
Rxrb T C 17: 34,032,847 probably benign Het
Sis T A 3: 72,928,235 K931N probably damaging Het
Srcap T A 7: 127,559,822 probably benign Het
Srp68 A G 11: 116,246,669 S525P probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Synj1 A G 16: 90,938,253 probably benign Het
Syt12 T C 19: 4,451,044 Y326C probably damaging Het
Tesk2 A G 4: 116,802,315 probably null Het
Tmem41b G A 7: 109,978,738 T113I possibly damaging Het
Tmtc2 T C 10: 105,370,046 I463V probably benign Het
Trak1 A T 9: 121,448,838 D320V probably damaging Het
Ushbp1 A T 8: 71,386,219 N570K probably benign Het
Vmn1r33 T A 6: 66,611,833 I246F possibly damaging Het
Vmn2r54 A C 7: 12,615,282 L791R possibly damaging Het
Washc1 A T 17: 66,118,116 T372S probably benign Het
Other mutations in Loxl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Loxl3 APN 6 83048766 unclassified probably benign
IGL01370:Loxl3 APN 6 83049487 missense probably damaging 1.00
IGL02126:Loxl3 APN 6 83048647 missense probably damaging 1.00
IGL02128:Loxl3 APN 6 83050583 missense probably damaging 1.00
R0241:Loxl3 UTSW 6 83050133 missense probably damaging 1.00
R0241:Loxl3 UTSW 6 83050133 missense probably damaging 1.00
R1725:Loxl3 UTSW 6 83035593 missense probably benign 0.00
R1771:Loxl3 UTSW 6 83049909 missense probably damaging 1.00
R2017:Loxl3 UTSW 6 83048977 missense probably damaging 0.99
R2291:Loxl3 UTSW 6 83037488 missense probably benign 0.07
R3731:Loxl3 UTSW 6 83050671 critical splice donor site probably null
R4179:Loxl3 UTSW 6 83037584 missense probably benign 0.00
R5230:Loxl3 UTSW 6 83035794 missense probably benign 0.16
R5385:Loxl3 UTSW 6 83050612 missense probably damaging 0.99
R5591:Loxl3 UTSW 6 83048037 missense probably damaging 1.00
R5664:Loxl3 UTSW 6 83049882 missense probably benign 0.12
R5771:Loxl3 UTSW 6 83035799 splice site probably null
R5802:Loxl3 UTSW 6 83049289 missense possibly damaging 0.67
R5831:Loxl3 UTSW 6 83049018 missense probably benign 0.01
R5945:Loxl3 UTSW 6 83037511 missense probably damaging 1.00
R6542:Loxl3 UTSW 6 83048166 missense probably benign 0.00
R6687:Loxl3 UTSW 6 83050664 missense probably damaging 1.00
R7961:Loxl3 UTSW 6 83050809 missense possibly damaging 0.88
R8009:Loxl3 UTSW 6 83050809 missense possibly damaging 0.88
R8122:Loxl3 UTSW 6 83049259 missense probably damaging 1.00
R8278:Loxl3 UTSW 6 83048716 missense probably damaging 1.00
R8373:Loxl3 UTSW 6 83048891 missense possibly damaging 0.89
R8411:Loxl3 UTSW 6 83050624 missense probably damaging 1.00
R8539:Loxl3 UTSW 6 83049526 missense probably benign
R8684:Loxl3 UTSW 6 83035585 missense probably benign 0.23
R8782:Loxl3 UTSW 6 83048070 missense probably benign
R8801:Loxl3 UTSW 6 83048648 missense probably damaging 1.00
R8859:Loxl3 UTSW 6 83037545 missense probably damaging 1.00
R8864:Loxl3 UTSW 6 83035758 missense probably damaging 0.99
V1024:Loxl3 UTSW 6 83035738 missense probably damaging 1.00
X0009:Loxl3 UTSW 6 83038480 missense probably damaging 1.00
Z1177:Loxl3 UTSW 6 83038578 nonsense probably null
Z1177:Loxl3 UTSW 6 83048160 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCAGGAAACTACATTCTTCAGG -3'
(R):5'- GCTTCTTCGCTGAAGGCATC -3'

Sequencing Primer
(F):5'- GGAAACTACATTCTTCAGGTGCCTAG -3'
(R):5'- TCACCTGCAGAATAGACAGGC -3'
Posted On2016-11-21