Incidental Mutation 'R5769:Magel2'
ID446437
Institutional Source Beutler Lab
Gene Symbol Magel2
Ensembl Gene ENSMUSG00000056972
Gene Namemelanoma antigen, family L, 2
SynonymsnM15, ns7, NDNL1, Mage-l2
MMRRC Submission 043369-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5769 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location62377010-62381640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62378113 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 255 (M255K)
Ref Sequence ENSEMBL: ENSMUSP00000079265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080403]
Predicted Effect probably benign
Transcript: ENSMUST00000080403
AA Change: M255K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000079265
Gene: ENSMUSG00000056972
AA Change: M255K

DomainStartEndE-ValueType
low complexity region 30 49 N/A INTRINSIC
low complexity region 51 84 N/A INTRINSIC
internal_repeat_1 85 131 2.45e-10 PROSPERO
low complexity region 134 205 N/A INTRINSIC
internal_repeat_1 222 298 2.45e-10 PROSPERO
internal_repeat_2 289 332 6.32e-5 PROSPERO
low complexity region 347 363 N/A INTRINSIC
low complexity region 467 492 N/A INTRINSIC
internal_repeat_2 494 535 6.32e-5 PROSPERO
low complexity region 560 648 N/A INTRINSIC
low complexity region 675 686 N/A INTRINSIC
low complexity region 761 785 N/A INTRINSIC
low complexity region 903 920 N/A INTRINSIC
MAGE 1059 1229 6.82e-65 SMART
low complexity region 1262 1284 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207232
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prader-Willi syndrome (PWS) is caused by the loss of expression of imprinted genes in chromosome 15q11-q13 region. Affected individuals exhibit neonatal hypotonia, developmental delay, and childhood-onset obesity. Necdin (NDN), a gene involved in the terminal differentiation of neurons, localizes to this region of the genome and has been implicated as one of the genes responsible for the etiology of PWS. This gene is structurally similar to NDN, is also localized to the PWS chromosomal region, and is paternally imprinted, suggesting a possible role for it in PWS. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice heterozygous for a null allele that is inherited paternally exhibit some postnatal lethality, reduced male fertility, abnormal circadian rhythm, and hypoactivity. Mice heterozygous for another paternal knock-out allele exhibit 50% neonatal lethalityassociated with weak suckling activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,333 V160E possibly damaging Het
Abcb1a A C 5: 8,683,426 E106A probably benign Het
Acap3 A T 4: 155,902,400 D371V probably damaging Het
Ahi1 T C 10: 20,960,082 probably null Het
Coq8a A G 1: 180,179,116 Y69H probably damaging Het
Defb33 T A 8: 20,897,527 F27I possibly damaging Het
Dhx29 T A 13: 112,953,717 L776Q probably damaging Het
Dnah3 G A 7: 120,089,952 R80* probably null Het
Dtna A T 18: 23,651,554 D646V probably benign Het
Eml5 T A 12: 98,790,619 D1964V probably damaging Het
Fbn2 A T 18: 58,105,199 N575K probably damaging Het
Fbxo38 G A 18: 62,514,965 P834L probably benign Het
Fyb2 G T 4: 105,013,321 K706N probably damaging Het
Fyb2 T A 4: 105,015,644 V738E probably damaging Het
Gcm1 A G 9: 78,064,967 T397A probably benign Het
Gins1 A T 2: 150,925,998 E149D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12845 A C 4: 117,728,965 probably benign Het
Gm14124 A G 2: 150,268,278 E296G possibly damaging Het
Grin2a C T 16: 9,761,526 R291K possibly damaging Het
Hdac10 T C 15: 89,123,616 M646V probably benign Het
Hes6 G T 1: 91,412,949 R38S probably damaging Het
Hipk3 G A 2: 104,434,953 P667S possibly damaging Het
Jrk T C 15: 74,706,068 Q456R probably benign Het
Loxl3 A G 6: 83,050,600 T708A probably damaging Het
Lyg1 T C 1: 37,950,750 S19G unknown Het
Mctp1 A G 13: 76,759,808 D242G probably damaging Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mms19 A G 19: 41,964,386 F95L probably damaging Het
Nav1 A G 1: 135,452,257 L1569P probably damaging Het
Nup188 A G 2: 30,330,735 E940G probably benign Het
Oas1d T C 5: 120,916,854 F163S probably benign Het
Odf2l A G 3: 145,135,731 K304R possibly damaging Het
Otud3 T A 4: 138,898,110 N211I possibly damaging Het
Pabpc6 A T 17: 9,667,843 L593* probably null Het
Pdcd11 T A 19: 47,102,637 L350Q possibly damaging Het
Pdia4 A G 6: 47,815,512 probably benign Het
Pik3cb G A 9: 99,093,159 Q223* probably null Het
Plb1 G A 5: 32,317,522 V696M probably benign Het
Ppp2r5a T C 1: 191,372,666 D61G probably benign Het
Preb G T 5: 30,958,291 Y87* probably null Het
Rdh16f2 A T 10: 127,876,889 N252I probably benign Het
Rida T C 15: 34,484,558 probably benign Het
Rxrb T C 17: 34,032,847 probably benign Het
Sis T A 3: 72,928,235 K931N probably damaging Het
Srcap T A 7: 127,559,822 probably benign Het
Srp68 A G 11: 116,246,669 S525P probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Synj1 A G 16: 90,938,253 probably benign Het
Syt12 T C 19: 4,451,044 Y326C probably damaging Het
Tesk2 A G 4: 116,802,315 probably null Het
Tmem41b G A 7: 109,978,738 T113I possibly damaging Het
Tmtc2 T C 10: 105,370,046 I463V probably benign Het
Trak1 A T 9: 121,448,838 D320V probably damaging Het
Ushbp1 A T 8: 71,386,219 N570K probably benign Het
Vmn1r33 T A 6: 66,611,833 I246F possibly damaging Het
Vmn2r54 A C 7: 12,615,282 L791R possibly damaging Het
Washc1 A T 17: 66,118,116 T372S probably benign Het
Other mutations in Magel2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Magel2 APN 7 62379322 missense unknown
IGL01391:Magel2 APN 7 62380884 missense unknown
IGL01876:Magel2 APN 7 62378827 missense possibly damaging 0.68
IGL02613:Magel2 APN 7 62380198 missense unknown
IGL02617:Magel2 APN 7 62380198 missense unknown
IGL03256:Magel2 APN 7 62380414 missense unknown
IGL03382:Magel2 APN 7 62378713 missense probably benign 0.00
astroclast2 UTSW 7 62380159 missense unknown
IGL02837:Magel2 UTSW 7 62378260 missense possibly damaging 0.93
R0398:Magel2 UTSW 7 62380551 nonsense probably null
R0463:Magel2 UTSW 7 62378030 missense possibly damaging 0.53
R1033:Magel2 UTSW 7 62380050 missense unknown
R1271:Magel2 UTSW 7 62381014 missense unknown
R1518:Magel2 UTSW 7 62380440 missense unknown
R1539:Magel2 UTSW 7 62378809 missense possibly damaging 0.91
R1682:Magel2 UTSW 7 62380235 missense unknown
R1686:Magel2 UTSW 7 62378240 missense possibly damaging 0.53
R1782:Magel2 UTSW 7 62380857 nonsense probably null
R1785:Magel2 UTSW 7 62377738 missense unknown
R1786:Magel2 UTSW 7 62377738 missense unknown
R1950:Magel2 UTSW 7 62378415 missense possibly damaging 0.48
R2001:Magel2 UTSW 7 62379096 missense unknown
R2002:Magel2 UTSW 7 62379096 missense unknown
R2018:Magel2 UTSW 7 62379096 missense unknown
R2019:Magel2 UTSW 7 62379096 missense unknown
R2029:Magel2 UTSW 7 62380594 missense unknown
R2070:Magel2 UTSW 7 62379096 missense unknown
R2131:Magel2 UTSW 7 62377738 missense unknown
R2132:Magel2 UTSW 7 62377738 missense unknown
R2133:Magel2 UTSW 7 62377738 missense unknown
R2134:Magel2 UTSW 7 62379096 missense unknown
R2155:Magel2 UTSW 7 62380792 missense unknown
R4294:Magel2 UTSW 7 62378767 missense possibly damaging 0.86
R4591:Magel2 UTSW 7 62381089 missense unknown
R4621:Magel2 UTSW 7 62377738 missense unknown
R4816:Magel2 UTSW 7 62381092 missense unknown
R4931:Magel2 UTSW 7 62380624 missense unknown
R5031:Magel2 UTSW 7 62380104 missense unknown
R5034:Magel2 UTSW 7 62379868 missense unknown
R5042:Magel2 UTSW 7 62379606 missense unknown
R5600:Magel2 UTSW 7 62379766 missense unknown
R5980:Magel2 UTSW 7 62380596 missense unknown
R5987:Magel2 UTSW 7 62378767 missense probably benign 0.33
R6187:Magel2 UTSW 7 62377641 missense unknown
R6267:Magel2 UTSW 7 62378679 missense probably damaging 0.98
R6270:Magel2 UTSW 7 62380658 nonsense probably null
R6316:Magel2 UTSW 7 62378719 missense possibly damaging 0.68
R6444:Magel2 UTSW 7 62379999 missense unknown
R6452:Magel2 UTSW 7 62380384 missense unknown
R6797:Magel2 UTSW 7 62380159 missense unknown
R6917:Magel2 UTSW 7 62377844 small deletion probably benign
R7011:Magel2 UTSW 7 62378533 missense possibly damaging 0.92
R7025:Magel2 UTSW 7 62379787 missense unknown
R7335:Magel2 UTSW 7 62380776 missense unknown
R7353:Magel2 UTSW 7 62379331 missense unknown
R7413:Magel2 UTSW 7 62377844 small deletion probably benign
R7570:Magel2 UTSW 7 62378910 missense possibly damaging 0.53
R7714:Magel2 UTSW 7 62378382 missense probably benign 0.08
R7836:Magel2 UTSW 7 62378368 missense possibly damaging 0.73
R8289:Magel2 UTSW 7 62379127 missense unknown
R8717:Magel2 UTSW 7 62377672 missense unknown
R8903:Magel2 UTSW 7 62379693 missense unknown
R8911:Magel2 UTSW 7 62379789 missense unknown
RF022:Magel2 UTSW 7 62380093 missense unknown
Z1088:Magel2 UTSW 7 62378977 missense possibly damaging 0.53
Z1177:Magel2 UTSW 7 62379607 missense unknown
Predicted Primers PCR Primer
(F):5'- TACATCCTTCTGTCACGGGG -3'
(R):5'- TGCTCCTGATACTGGAGTCTG -3'

Sequencing Primer
(F):5'- TCCTGGGACCCCAATGAC -3'
(R):5'- CTGAATGATTGGACCTCTGGCAC -3'
Posted On2016-11-21