Incidental Mutation 'R5769:Mctp1'
ID446455
Institutional Source Beutler Lab
Gene Symbol Mctp1
Ensembl Gene ENSMUSG00000021596
Gene Namemultiple C2 domains, transmembrane 1
Synonyms
MMRRC Submission 043369-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5769 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location76384535-77031810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76759808 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 242 (D242G)
Ref Sequence ENSEMBL: ENSMUSP00000105212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109583] [ENSMUST00000125209] [ENSMUST00000126960]
Predicted Effect probably damaging
Transcript: ENSMUST00000109583
AA Change: D242G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105212
Gene: ENSMUSG00000021596
AA Change: D242G

DomainStartEndE-ValueType
C2 3 100 1.15e-15 SMART
C2 166 263 1.35e-21 SMART
C2 322 418 4.76e-22 SMART
transmembrane domain 513 535 N/A INTRINSIC
Pfam:PRT_C 542 672 3.3e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125209
AA Change: D499G

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118958
Gene: ENSMUSG00000021596
AA Change: D499G

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
low complexity region 49 63 N/A INTRINSIC
low complexity region 134 174 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
C2 260 357 1.15e-15 SMART
C2 423 520 1.35e-21 SMART
C2 579 675 4.76e-22 SMART
transmembrane domain 770 792 N/A INTRINSIC
Pfam:PRT_C 800 929 2.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126960
AA Change: D266G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120673
Gene: ENSMUSG00000021596
AA Change: D266G

DomainStartEndE-ValueType
C2 40 137 1.15e-15 SMART
C2 190 286 8.43e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137052
Meta Mutation Damage Score 0.9335 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,333 V160E possibly damaging Het
Abcb1a A C 5: 8,683,426 E106A probably benign Het
Acap3 A T 4: 155,902,400 D371V probably damaging Het
Ahi1 T C 10: 20,960,082 probably null Het
Coq8a A G 1: 180,179,116 Y69H probably damaging Het
Defb33 T A 8: 20,897,527 F27I possibly damaging Het
Dhx29 T A 13: 112,953,717 L776Q probably damaging Het
Dnah3 G A 7: 120,089,952 R80* probably null Het
Dtna A T 18: 23,651,554 D646V probably benign Het
Eml5 T A 12: 98,790,619 D1964V probably damaging Het
Fbn2 A T 18: 58,105,199 N575K probably damaging Het
Fbxo38 G A 18: 62,514,965 P834L probably benign Het
Fyb2 G T 4: 105,013,321 K706N probably damaging Het
Fyb2 T A 4: 105,015,644 V738E probably damaging Het
Gcm1 A G 9: 78,064,967 T397A probably benign Het
Gins1 A T 2: 150,925,998 E149D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12845 A C 4: 117,728,965 probably benign Het
Gm14124 A G 2: 150,268,278 E296G possibly damaging Het
Grin2a C T 16: 9,761,526 R291K possibly damaging Het
Hdac10 T C 15: 89,123,616 M646V probably benign Het
Hes6 G T 1: 91,412,949 R38S probably damaging Het
Hipk3 G A 2: 104,434,953 P667S possibly damaging Het
Jrk T C 15: 74,706,068 Q456R probably benign Het
Loxl3 A G 6: 83,050,600 T708A probably damaging Het
Lyg1 T C 1: 37,950,750 S19G unknown Het
Magel2 T A 7: 62,378,113 M255K probably benign Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mms19 A G 19: 41,964,386 F95L probably damaging Het
Nav1 A G 1: 135,452,257 L1569P probably damaging Het
Nup188 A G 2: 30,330,735 E940G probably benign Het
Oas1d T C 5: 120,916,854 F163S probably benign Het
Odf2l A G 3: 145,135,731 K304R possibly damaging Het
Otud3 T A 4: 138,898,110 N211I possibly damaging Het
Pabpc6 A T 17: 9,667,843 L593* probably null Het
Pdcd11 T A 19: 47,102,637 L350Q possibly damaging Het
Pdia4 A G 6: 47,815,512 probably benign Het
Pik3cb G A 9: 99,093,159 Q223* probably null Het
Plb1 G A 5: 32,317,522 V696M probably benign Het
Ppp2r5a T C 1: 191,372,666 D61G probably benign Het
Preb G T 5: 30,958,291 Y87* probably null Het
Rdh16f2 A T 10: 127,876,889 N252I probably benign Het
Rida T C 15: 34,484,558 probably benign Het
Rxrb T C 17: 34,032,847 probably benign Het
Sis T A 3: 72,928,235 K931N probably damaging Het
Srcap T A 7: 127,559,822 probably benign Het
Srp68 A G 11: 116,246,669 S525P probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Synj1 A G 16: 90,938,253 probably benign Het
Syt12 T C 19: 4,451,044 Y326C probably damaging Het
Tesk2 A G 4: 116,802,315 probably null Het
Tmem41b G A 7: 109,978,738 T113I possibly damaging Het
Tmtc2 T C 10: 105,370,046 I463V probably benign Het
Trak1 A T 9: 121,448,838 D320V probably damaging Het
Ushbp1 A T 8: 71,386,219 N570K probably benign Het
Vmn1r33 T A 6: 66,611,833 I246F possibly damaging Het
Vmn2r54 A C 7: 12,615,282 L791R possibly damaging Het
Washc1 A T 17: 66,118,116 T372S probably benign Het
Other mutations in Mctp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Mctp1 APN 13 77020798 missense probably damaging 0.98
IGL01355:Mctp1 APN 13 76384955 missense probably benign
IGL02192:Mctp1 APN 13 76731768 intron probably benign
IGL02342:Mctp1 APN 13 77024857 missense probably damaging 1.00
IGL02706:Mctp1 APN 13 76823069 missense probably damaging 1.00
IGL02950:Mctp1 APN 13 77024810 missense probably damaging 1.00
IGL03064:Mctp1 APN 13 76801513 nonsense probably null
IGL03230:Mctp1 APN 13 76824857 missense possibly damaging 0.49
R0138:Mctp1 UTSW 13 76827712 missense probably damaging 1.00
R0355:Mctp1 UTSW 13 76824863 missense probably damaging 1.00
R0383:Mctp1 UTSW 13 76801544 missense probably damaging 1.00
R0426:Mctp1 UTSW 13 77020821 missense probably benign 0.01
R0462:Mctp1 UTSW 13 76801401 missense probably damaging 1.00
R0483:Mctp1 UTSW 13 76827727 missense probably damaging 1.00
R0685:Mctp1 UTSW 13 76825799 critical splice donor site probably null
R1468:Mctp1 UTSW 13 76825273 missense probably benign 0.25
R1468:Mctp1 UTSW 13 76825273 missense probably benign 0.25
R1854:Mctp1 UTSW 13 76825741 missense probably damaging 0.96
R1864:Mctp1 UTSW 13 76385148 missense possibly damaging 0.63
R1865:Mctp1 UTSW 13 76385148 missense possibly damaging 0.63
R1920:Mctp1 UTSW 13 76384610 missense possibly damaging 0.67
R2071:Mctp1 UTSW 13 76759724 missense probably damaging 1.00
R2127:Mctp1 UTSW 13 76824822 missense probably damaging 1.00
R2128:Mctp1 UTSW 13 76824822 missense probably damaging 1.00
R2129:Mctp1 UTSW 13 76824822 missense probably damaging 1.00
R3709:Mctp1 UTSW 13 76824880 splice site probably null
R4463:Mctp1 UTSW 13 76712087 missense probably damaging 1.00
R4510:Mctp1 UTSW 13 76825272 missense probably benign 0.20
R4511:Mctp1 UTSW 13 76825272 missense probably benign 0.20
R4951:Mctp1 UTSW 13 76827775 missense probably damaging 0.96
R5004:Mctp1 UTSW 13 76641804 missense possibly damaging 0.79
R5307:Mctp1 UTSW 13 76712079 critical splice acceptor site probably null
R5339:Mctp1 UTSW 13 76825706 intron probably benign
R5639:Mctp1 UTSW 13 77024783 splice site silent
R5800:Mctp1 UTSW 13 76688559 missense probably damaging 1.00
R5913:Mctp1 UTSW 13 76759825 splice site probably null
R5981:Mctp1 UTSW 13 76757110 missense probably damaging 1.00
R6024:Mctp1 UTSW 13 76385161 missense probably damaging 0.98
R6192:Mctp1 UTSW 13 76822963 splice site probably null
R6331:Mctp1 UTSW 13 77020863 critical splice donor site probably null
R6468:Mctp1 UTSW 13 76731811 critical splice donor site probably null
R6484:Mctp1 UTSW 13 76688625 missense probably benign 0.02
R6656:Mctp1 UTSW 13 77029936 missense probably damaging 0.99
R7026:Mctp1 UTSW 13 76806259 missense probably benign 0.35
R7482:Mctp1 UTSW 13 76741460 splice site probably null
R7890:Mctp1 UTSW 13 76827757 missense probably damaging 1.00
R7942:Mctp1 UTSW 13 76641710 critical splice acceptor site probably null
R8029:Mctp1 UTSW 13 77029886 missense probably damaging 1.00
R8034:Mctp1 UTSW 13 76891551 missense probably damaging 0.99
R8085:Mctp1 UTSW 13 76824853 missense probably benign 0.00
R8258:Mctp1 UTSW 13 76801547 critical splice donor site probably null
R8259:Mctp1 UTSW 13 76801547 critical splice donor site probably null
R8286:Mctp1 UTSW 13 76757055 missense probably benign 0.22
R8713:Mctp1 UTSW 13 76641803 missense probably benign
Z1189:Mctp1 UTSW 13 76823042 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGGTTGAATGAACTACCGCCC -3'
(R):5'- GTCATGGAATCCACACCCTAGC -3'

Sequencing Primer
(F):5'- GGTTGAATGAACTACCGCCCTTAAG -3'
(R):5'- GAAGGTTCCTTCCTTCGA -3'
Posted On2016-11-21