Incidental Mutation 'R5769:Jrk'
ID446458
Institutional Source Beutler Lab
Gene Symbol Jrk
Ensembl Gene ENSMUSG00000046380
Gene Namejerky
Synonyms
MMRRC Submission 043369-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5769 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location74702301-74709535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74706068 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 456 (Q456R)
Ref Sequence ENSEMBL: ENSMUSP00000051842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050234]
Predicted Effect probably benign
Transcript: ENSMUST00000050234
AA Change: Q456R

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000051842
Gene: ENSMUSG00000046380
AA Change: Q456R

DomainStartEndE-ValueType
Pfam:CENP-B_N 14 66 5.3e-27 PFAM
CENPB 83 149 8.82e-24 SMART
Pfam:DDE_1 213 382 2.2e-46 PFAM
low complexity region 395 405 N/A INTRINSIC
low complexity region 468 481 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056711
SMART Domains Protein: ENSMUSP00000060582
Gene: ENSMUSG00000044276

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185751
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein that is similar to DNA-binding proteins, such as major centromere autoantigen B (CENPB). Inactivation of the related gene in mice resulted in epileptic seizures. Childhood Absence Epilepsy (CAE) has been mapped to the same chromosomal location (8q24.3) as this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Heterozygous mutants show whole body jerks, clonic seizures and epileptic brain activity. Homozygous mutants show elevated seizure susceptibility, impaired postnatal growth, reduced life span, male sterility and impaired female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,333 V160E possibly damaging Het
Abcb1a A C 5: 8,683,426 E106A probably benign Het
Acap3 A T 4: 155,902,400 D371V probably damaging Het
Ahi1 T C 10: 20,960,082 probably null Het
Coq8a A G 1: 180,179,116 Y69H probably damaging Het
Defb33 T A 8: 20,897,527 F27I possibly damaging Het
Dhx29 T A 13: 112,953,717 L776Q probably damaging Het
Dnah3 G A 7: 120,089,952 R80* probably null Het
Dtna A T 18: 23,651,554 D646V probably benign Het
Eml5 T A 12: 98,790,619 D1964V probably damaging Het
Fbn2 A T 18: 58,105,199 N575K probably damaging Het
Fbxo38 G A 18: 62,514,965 P834L probably benign Het
Fyb2 G T 4: 105,013,321 K706N probably damaging Het
Fyb2 T A 4: 105,015,644 V738E probably damaging Het
Gcm1 A G 9: 78,064,967 T397A probably benign Het
Gins1 A T 2: 150,925,998 E149D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12845 A C 4: 117,728,965 probably benign Het
Gm14124 A G 2: 150,268,278 E296G possibly damaging Het
Grin2a C T 16: 9,761,526 R291K possibly damaging Het
Hdac10 T C 15: 89,123,616 M646V probably benign Het
Hes6 G T 1: 91,412,949 R38S probably damaging Het
Hipk3 G A 2: 104,434,953 P667S possibly damaging Het
Loxl3 A G 6: 83,050,600 T708A probably damaging Het
Lyg1 T C 1: 37,950,750 S19G unknown Het
Magel2 T A 7: 62,378,113 M255K probably benign Het
Mctp1 A G 13: 76,759,808 D242G probably damaging Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mms19 A G 19: 41,964,386 F95L probably damaging Het
Nav1 A G 1: 135,452,257 L1569P probably damaging Het
Nup188 A G 2: 30,330,735 E940G probably benign Het
Oas1d T C 5: 120,916,854 F163S probably benign Het
Odf2l A G 3: 145,135,731 K304R possibly damaging Het
Otud3 T A 4: 138,898,110 N211I possibly damaging Het
Pabpc6 A T 17: 9,667,843 L593* probably null Het
Pdcd11 T A 19: 47,102,637 L350Q possibly damaging Het
Pdia4 A G 6: 47,815,512 probably benign Het
Pik3cb G A 9: 99,093,159 Q223* probably null Het
Plb1 G A 5: 32,317,522 V696M probably benign Het
Ppp2r5a T C 1: 191,372,666 D61G probably benign Het
Preb G T 5: 30,958,291 Y87* probably null Het
Rdh16f2 A T 10: 127,876,889 N252I probably benign Het
Rida T C 15: 34,484,558 probably benign Het
Rxrb T C 17: 34,032,847 probably benign Het
Sis T A 3: 72,928,235 K931N probably damaging Het
Srcap T A 7: 127,559,822 probably benign Het
Srp68 A G 11: 116,246,669 S525P probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Synj1 A G 16: 90,938,253 probably benign Het
Syt12 T C 19: 4,451,044 Y326C probably damaging Het
Tesk2 A G 4: 116,802,315 probably null Het
Tmem41b G A 7: 109,978,738 T113I possibly damaging Het
Tmtc2 T C 10: 105,370,046 I463V probably benign Het
Trak1 A T 9: 121,448,838 D320V probably damaging Het
Ushbp1 A T 8: 71,386,219 N570K probably benign Het
Vmn1r33 T A 6: 66,611,833 I246F possibly damaging Het
Vmn2r54 A C 7: 12,615,282 L791R possibly damaging Het
Washc1 A T 17: 66,118,116 T372S probably benign Het
Other mutations in Jrk
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0144:Jrk UTSW 15 74706156 missense probably benign 0.01
R1871:Jrk UTSW 15 74706563 missense possibly damaging 0.91
R3417:Jrk UTSW 15 74706885 missense probably damaging 0.96
R4867:Jrk UTSW 15 74707220 missense probably benign 0.00
R5294:Jrk UTSW 15 74707336 missense possibly damaging 0.88
R5911:Jrk UTSW 15 74705768 missense possibly damaging 0.88
R6123:Jrk UTSW 15 74706680 missense possibly damaging 0.46
R6176:Jrk UTSW 15 74706340 missense possibly damaging 0.47
R7411:Jrk UTSW 15 74707199 missense possibly damaging 0.47
R7480:Jrk UTSW 15 74707053 missense probably benign 0.16
Z1088:Jrk UTSW 15 74707394 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTGATCACAGCCCTGAGAG -3'
(R):5'- CTGTCACGTTCACTGAAGGC -3'

Sequencing Primer
(F):5'- GCTGCTGCTGTCTCCTGAAC -3'
(R):5'- ACTGAAGGCTCCTCCTCTGAG -3'
Posted On2016-11-21