Incidental Mutation 'R5769:Rxrb'
ID446463
Institutional Source Beutler Lab
Gene Symbol Rxrb
Ensembl Gene ENSMUSG00000039656
Gene Nameretinoid X receptor beta
SynonymsNr2b2, Rub, RCoR-1, H-2RIIBP
MMRRC Submission 043369-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.868) question?
Stock #R5769 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34031812-34038393 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to C at 34032847 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025186] [ENSMUST00000044858] [ENSMUST00000045467] [ENSMUST00000114303] [ENSMUST00000116612] [ENSMUST00000169397] [ENSMUST00000171872] [ENSMUST00000173354] [ENSMUST00000173554]
Predicted Effect probably benign
Transcript: ENSMUST00000025186
SMART Domains Protein: ENSMUSP00000025186
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 473 2.4e-83 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000044858
AA Change: S83P
SMART Domains Protein: ENSMUSP00000036585
Gene: ENSMUSG00000039656
AA Change: S83P

DomainStartEndE-ValueType
low complexity region 66 85 N/A INTRINSIC
low complexity region 94 121 N/A INTRINSIC
low complexity region 124 147 N/A INTRINSIC
low complexity region 179 186 N/A INTRINSIC
ZnF_C4 189 260 3.98e-39 SMART
low complexity region 269 282 N/A INTRINSIC
low complexity region 305 316 N/A INTRINSIC
HOLI 328 491 1.91e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000045467
SMART Domains Protein: ENSMUSP00000038069
Gene: ENSMUSG00000073422

DomainStartEndE-ValueType
Pfam:KR 10 201 1.5e-16 PFAM
Pfam:adh_short 10 213 4.5e-52 PFAM
Pfam:adh_short_C2 16 258 8.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114303
SMART Domains Protein: ENSMUSP00000133546
Gene: ENSMUSG00000073422

DomainStartEndE-ValueType
Pfam:KR 10 202 5.5e-16 PFAM
Pfam:adh_short 22 193 2.7e-30 PFAM
Pfam:adh_short_C2 23 234 1.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116612
SMART Domains Protein: ENSMUSP00000112311
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 2 76 4.3e-10 PFAM
ZnF_C4 79 150 3.98e-39 SMART
low complexity region 159 172 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
HOLI 218 377 1.35e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168978
Predicted Effect probably benign
Transcript: ENSMUST00000169397
SMART Domains Protein: ENSMUSP00000130102
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 473 1.9e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170644
Predicted Effect probably benign
Transcript: ENSMUST00000171872
SMART Domains Protein: ENSMUSP00000133146
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 246 4.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173354
SMART Domains Protein: ENSMUSP00000133661
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 2 76 4.3e-10 PFAM
ZnF_C4 79 150 3.98e-39 SMART
low complexity region 159 172 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
HOLI 218 381 1.91e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173554
SMART Domains Protein: ENSMUSP00000134299
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 2 76 4.9e-11 PFAM
ZnF_C4 79 150 3.98e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174130
Predicted Effect unknown
Transcript: ENSMUST00000174299
AA Change: S21P
SMART Domains Protein: ENSMUSP00000133775
Gene: ENSMUSG00000039656
AA Change: S21P

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 25 52 N/A INTRINSIC
low complexity region 55 78 N/A INTRINSIC
low complexity region 110 117 N/A INTRINSIC
ZnF_C4 120 191 3.98e-39 SMART
low complexity region 200 213 N/A INTRINSIC
low complexity region 236 247 N/A INTRINSIC
HOLI 259 418 1.35e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174740
Meta Mutation Damage Score 0.0962 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the retinoid X receptor (RXR) family of nuclear receptors which are involved in mediating the effects of retinoic acid (RA). The encoded protein forms homodimers with the retinoic acid, thyroid hormone, and vitamin D receptors, increasing both DNA binding and transcriptional function on their respective response elements. This gene lies within the major histocompatibility complex (MHC) class II region on chromosome 6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mutant mice homozygous for a null mutation exhibit partial embryonic and perinatal lethality, and surviving adult males are sterile due to defects in spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,333 V160E possibly damaging Het
Abcb1a A C 5: 8,683,426 E106A probably benign Het
Acap3 A T 4: 155,902,400 D371V probably damaging Het
Ahi1 T C 10: 20,960,082 probably null Het
Coq8a A G 1: 180,179,116 Y69H probably damaging Het
Defb33 T A 8: 20,897,527 F27I possibly damaging Het
Dhx29 T A 13: 112,953,717 L776Q probably damaging Het
Dnah3 G A 7: 120,089,952 R80* probably null Het
Dtna A T 18: 23,651,554 D646V probably benign Het
Eml5 T A 12: 98,790,619 D1964V probably damaging Het
Fbn2 A T 18: 58,105,199 N575K probably damaging Het
Fbxo38 G A 18: 62,514,965 P834L probably benign Het
Fyb2 G T 4: 105,013,321 K706N probably damaging Het
Fyb2 T A 4: 105,015,644 V738E probably damaging Het
Gcm1 A G 9: 78,064,967 T397A probably benign Het
Gins1 A T 2: 150,925,998 E149D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12845 A C 4: 117,728,965 probably benign Het
Gm14124 A G 2: 150,268,278 E296G possibly damaging Het
Grin2a C T 16: 9,761,526 R291K possibly damaging Het
Hdac10 T C 15: 89,123,616 M646V probably benign Het
Hes6 G T 1: 91,412,949 R38S probably damaging Het
Hipk3 G A 2: 104,434,953 P667S possibly damaging Het
Jrk T C 15: 74,706,068 Q456R probably benign Het
Loxl3 A G 6: 83,050,600 T708A probably damaging Het
Lyg1 T C 1: 37,950,750 S19G unknown Het
Magel2 T A 7: 62,378,113 M255K probably benign Het
Mctp1 A G 13: 76,759,808 D242G probably damaging Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mms19 A G 19: 41,964,386 F95L probably damaging Het
Nav1 A G 1: 135,452,257 L1569P probably damaging Het
Nup188 A G 2: 30,330,735 E940G probably benign Het
Oas1d T C 5: 120,916,854 F163S probably benign Het
Odf2l A G 3: 145,135,731 K304R possibly damaging Het
Otud3 T A 4: 138,898,110 N211I possibly damaging Het
Pabpc6 A T 17: 9,667,843 L593* probably null Het
Pdcd11 T A 19: 47,102,637 L350Q possibly damaging Het
Pdia4 A G 6: 47,815,512 probably benign Het
Pik3cb G A 9: 99,093,159 Q223* probably null Het
Plb1 G A 5: 32,317,522 V696M probably benign Het
Ppp2r5a T C 1: 191,372,666 D61G probably benign Het
Preb G T 5: 30,958,291 Y87* probably null Het
Rdh16f2 A T 10: 127,876,889 N252I probably benign Het
Rida T C 15: 34,484,558 probably benign Het
Sis T A 3: 72,928,235 K931N probably damaging Het
Srcap T A 7: 127,559,822 probably benign Het
Srp68 A G 11: 116,246,669 S525P probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Synj1 A G 16: 90,938,253 probably benign Het
Syt12 T C 19: 4,451,044 Y326C probably damaging Het
Tesk2 A G 4: 116,802,315 probably null Het
Tmem41b G A 7: 109,978,738 T113I possibly damaging Het
Tmtc2 T C 10: 105,370,046 I463V probably benign Het
Trak1 A T 9: 121,448,838 D320V probably damaging Het
Ushbp1 A T 8: 71,386,219 N570K probably benign Het
Vmn1r33 T A 6: 66,611,833 I246F possibly damaging Het
Vmn2r54 A C 7: 12,615,282 L791R possibly damaging Het
Washc1 A T 17: 66,118,116 T372S probably benign Het
Other mutations in Rxrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Rxrb APN 17 34034075 missense probably damaging 1.00
IGL01337:Rxrb APN 17 34036631 missense probably damaging 1.00
I2505:Rxrb UTSW 17 34033549 splice site probably benign
R0571:Rxrb UTSW 17 34032132 unclassified probably benign
R1463:Rxrb UTSW 17 34034160 missense probably damaging 1.00
R2312:Rxrb UTSW 17 34032129 unclassified probably benign
R2395:Rxrb UTSW 17 34037438 missense probably damaging 1.00
R2935:Rxrb UTSW 17 34032132 unclassified probably benign
R3978:Rxrb UTSW 17 34036326 missense possibly damaging 0.92
R5119:Rxrb UTSW 17 34033588 missense probably benign 0.10
R5523:Rxrb UTSW 17 34036437 missense probably damaging 1.00
R5638:Rxrb UTSW 17 34037407 missense probably damaging 1.00
R5894:Rxrb UTSW 17 34035744 missense probably damaging 1.00
R6373:Rxrb UTSW 17 34033559 missense probably benign 0.08
R7798:Rxrb UTSW 17 34033605 missense probably damaging 1.00
Z1177:Rxrb UTSW 17 34032127 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCCACTTGGTATTTCTGAAC -3'
(R):5'- GGTTTTGGGGAAGTTCACCC -3'

Sequencing Primer
(F):5'- CACTTGGTATTTCTGAACTCCAGGG -3'
(R):5'- TTTGGGGAAGTTCACCCAAAGATG -3'
Posted On2016-11-21