Incidental Mutation 'R5769:Syt12'
ID446468
Institutional Source Beutler Lab
Gene Symbol Syt12
Ensembl Gene ENSMUSG00000049303
Gene Namesynaptotagmin XII
Synonyms
MMRRC Submission 043369-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5769 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4445908-4477447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4451044 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 326 (Y326C)
Ref Sequence ENSEMBL: ENSMUSP00000055237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059295]
Predicted Effect probably damaging
Transcript: ENSMUST00000059295
AA Change: Y326C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055237
Gene: ENSMUSG00000049303
AA Change: Y326C

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 45 55 N/A INTRINSIC
C2 168 272 1.8e-6 SMART
C2 299 405 4.9e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154407
Meta Mutation Damage Score 0.8196 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. Studies of the orthologous gene in rat have shown that the encoded protein selectively modulates spontaneous synaptic-vesicle exocytosis and may also be involved in regulating calcium independent secretion in nonneuronal cells. Alternative splicing results in multiple transcript variants. The gene has previously been referred to as synaptotagmin XI but has been renamed synaptotagmin XII to be standard with mouse and rat official nomenclature.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-in allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,333 V160E possibly damaging Het
Abcb1a A C 5: 8,683,426 E106A probably benign Het
Acap3 A T 4: 155,902,400 D371V probably damaging Het
Ahi1 T C 10: 20,960,082 probably null Het
Coq8a A G 1: 180,179,116 Y69H probably damaging Het
Defb33 T A 8: 20,897,527 F27I possibly damaging Het
Dhx29 T A 13: 112,953,717 L776Q probably damaging Het
Dnah3 G A 7: 120,089,952 R80* probably null Het
Dtna A T 18: 23,651,554 D646V probably benign Het
Eml5 T A 12: 98,790,619 D1964V probably damaging Het
Fbn2 A T 18: 58,105,199 N575K probably damaging Het
Fbxo38 G A 18: 62,514,965 P834L probably benign Het
Fyb2 G T 4: 105,013,321 K706N probably damaging Het
Fyb2 T A 4: 105,015,644 V738E probably damaging Het
Gcm1 A G 9: 78,064,967 T397A probably benign Het
Gins1 A T 2: 150,925,998 E149D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12845 A C 4: 117,728,965 probably benign Het
Gm14124 A G 2: 150,268,278 E296G possibly damaging Het
Grin2a C T 16: 9,761,526 R291K possibly damaging Het
Hdac10 T C 15: 89,123,616 M646V probably benign Het
Hes6 G T 1: 91,412,949 R38S probably damaging Het
Hipk3 G A 2: 104,434,953 P667S possibly damaging Het
Jrk T C 15: 74,706,068 Q456R probably benign Het
Loxl3 A G 6: 83,050,600 T708A probably damaging Het
Lyg1 T C 1: 37,950,750 S19G unknown Het
Magel2 T A 7: 62,378,113 M255K probably benign Het
Mctp1 A G 13: 76,759,808 D242G probably damaging Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mms19 A G 19: 41,964,386 F95L probably damaging Het
Nav1 A G 1: 135,452,257 L1569P probably damaging Het
Nup188 A G 2: 30,330,735 E940G probably benign Het
Oas1d T C 5: 120,916,854 F163S probably benign Het
Odf2l A G 3: 145,135,731 K304R possibly damaging Het
Otud3 T A 4: 138,898,110 N211I possibly damaging Het
Pabpc6 A T 17: 9,667,843 L593* probably null Het
Pdcd11 T A 19: 47,102,637 L350Q possibly damaging Het
Pdia4 A G 6: 47,815,512 probably benign Het
Pik3cb G A 9: 99,093,159 Q223* probably null Het
Plb1 G A 5: 32,317,522 V696M probably benign Het
Ppp2r5a T C 1: 191,372,666 D61G probably benign Het
Preb G T 5: 30,958,291 Y87* probably null Het
Rdh16f2 A T 10: 127,876,889 N252I probably benign Het
Rida T C 15: 34,484,558 probably benign Het
Rxrb T C 17: 34,032,847 probably benign Het
Sis T A 3: 72,928,235 K931N probably damaging Het
Srcap T A 7: 127,559,822 probably benign Het
Srp68 A G 11: 116,246,669 S525P probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Synj1 A G 16: 90,938,253 probably benign Het
Tesk2 A G 4: 116,802,315 probably null Het
Tmem41b G A 7: 109,978,738 T113I possibly damaging Het
Tmtc2 T C 10: 105,370,046 I463V probably benign Het
Trak1 A T 9: 121,448,838 D320V probably damaging Het
Ushbp1 A T 8: 71,386,219 N570K probably benign Het
Vmn1r33 T A 6: 66,611,833 I246F possibly damaging Het
Vmn2r54 A C 7: 12,615,282 L791R possibly damaging Het
Washc1 A T 17: 66,118,116 T372S probably benign Het
Other mutations in Syt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Syt12 APN 19 4447845 missense probably damaging 0.99
IGL02045:Syt12 APN 19 4447734 missense probably damaging 1.00
IGL02942:Syt12 APN 19 4447830 missense probably benign 0.16
IGL03131:Syt12 APN 19 4456854 missense probably benign
R1308:Syt12 UTSW 19 4460735 missense probably damaging 0.99
R1830:Syt12 UTSW 19 4456883 missense probably benign
R1858:Syt12 UTSW 19 4447797 missense probably damaging 1.00
R4192:Syt12 UTSW 19 4447681 utr 3 prime probably benign
R5646:Syt12 UTSW 19 4456541 missense possibly damaging 0.54
R5785:Syt12 UTSW 19 4450994 missense possibly damaging 0.95
R6079:Syt12 UTSW 19 4456868 missense probably benign
R7017:Syt12 UTSW 19 4460867 intron probably null
R7043:Syt12 UTSW 19 4451021 missense probably benign 0.04
R7137:Syt12 UTSW 19 4453950 missense probably damaging 1.00
R8042:Syt12 UTSW 19 4453824 missense probably damaging 0.98
U15987:Syt12 UTSW 19 4456868 missense probably benign
Z1177:Syt12 UTSW 19 4453928 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTGAGGTCCCAAGAGGCAAC -3'
(R):5'- GTTACTGATAGAATGGGACTACGC -3'

Sequencing Primer
(F):5'- GTCCCAAGAGGCAACACTGG -3'
(R):5'- CCTGAGTCAAGAGATGCTGGTACTC -3'
Posted On2016-11-21