Incidental Mutation 'R5770:Olfr46'
ID446494
Institutional Source Beutler Lab
Gene Symbol Olfr46
Ensembl Gene ENSMUSG00000093942
Gene Nameolfactory receptor 46
SynonymsID12, IF5, MOR253-8, GA_x6K02T2PBJ9-42759973-42760905, IB7
MMRRC Submission 043370-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R5770 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140601269-140617678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140610943 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 259 (Y259C)
Ref Sequence ENSEMBL: ENSMUSP00000072445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072655] [ENSMUST00000211771] [ENSMUST00000214180]
Predicted Effect probably damaging
Transcript: ENSMUST00000072655
AA Change: Y259C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072445
Gene: ENSMUSG00000093942
AA Change: Y259C

DomainStartEndE-ValueType
Pfam:7tm_4 39 315 1.1e-50 PFAM
Pfam:7TM_GPCR_Srsx 43 209 5.9e-8 PFAM
Pfam:7tm_1 49 298 3.4e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211771
AA Change: Y251C

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214180
AA Change: Y251C

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.4023 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 93% (64/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030C10Rik T C 12: 20,815,459 noncoding transcript Het
Abhd8 A G 8: 71,457,328 V392A probably benign Het
AI481877 T C 4: 59,092,466 I238M probably benign Het
Alpk3 A G 7: 81,078,562 E480G probably benign Het
Ankfy1 C G 11: 72,760,256 H1011D probably damaging Het
Aoc3 T G 11: 101,331,752 Y271* probably null Het
Bcl9 T C 3: 97,215,175 I103V probably benign Het
Cgnl1 C T 9: 71,645,487 probably null Het
Cyp2c23 T A 19: 44,021,579 D109V probably damaging Het
Cyp2j13 A T 4: 96,077,432 W13R probably benign Het
D630003M21Rik T C 2: 158,195,580 probably benign Het
Desi2 A T 1: 178,256,495 probably benign Het
Dll3 T C 7: 28,299,009 E177G possibly damaging Het
Ern2 C T 7: 122,179,907 G238D possibly damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm6133 A G 18: 78,350,249 K153E probably benign Het
Gpr68 A T 12: 100,878,821 Y155N probably benign Het
Hcrtr2 T A 9: 76,259,666 I130F probably damaging Het
Hk1 T C 10: 62,286,449 K489R probably benign Het
Ints13 T C 6: 146,555,073 N425S probably damaging Het
Itpkc T C 7: 27,212,988 D578G probably damaging Het
Kcns3 A G 12: 11,092,249 S150P probably benign Het
Khdrbs3 T A 15: 69,049,463 probably null Het
Kif11 A G 19: 37,390,865 I335V probably benign Het
Lrrn4 C G 2: 132,872,156 C290S probably damaging Het
Macrod2 T C 2: 141,232,182 probably benign Het
Mgam A G 6: 40,669,804 N688S probably benign Het
Myh8 G A 11: 67,297,200 E933K probably damaging Het
Nat8f5 T C 6: 85,817,675 Y101C probably damaging Het
Nhlrc1 A G 13: 47,014,712 V23A probably benign Het
Nkx2-3 T A 19: 43,614,533 F193I probably damaging Het
Nlrp4b T A 7: 10,715,487 V172E probably benign Het
Nmrk1 G T 19: 18,645,074 R172S probably benign Het
Nudcd3 T C 11: 6,113,286 D201G probably damaging Het
Olfr1255 T A 2: 89,816,549 D68E probably damaging Het
Olfr1384 A G 11: 49,514,592 E318G unknown Het
Olfr205 A T 16: 59,329,151 Y119* probably null Het
Olfr314 G A 11: 58,786,594 R120H probably benign Het
Olfr679 A T 7: 105,090,895 I248N probably damaging Het
Olfr980 C T 9: 40,006,338 V204I probably benign Het
Oprm1 G A 10: 6,789,026 G51D probably damaging Het
Pcdh15 T A 10: 74,185,345 Y130* probably null Het
Pcdh9 G A 14: 93,886,943 T597I probably damaging Het
Pcdhb19 A G 18: 37,498,037 N295S possibly damaging Het
Pcnx3 T C 19: 5,681,579 probably benign Het
Pdzph1 A T 17: 58,879,151 I1215N probably damaging Het
Phf21a C T 2: 92,351,854 T405I possibly damaging Het
Pkd1l2 C A 8: 117,055,018 G763W probably damaging Het
Prox2 A G 12: 85,087,380 F591L probably benign Het
Robo3 T A 9: 37,419,201 H1033L possibly damaging Het
Sdha A T 13: 74,323,120 C222* probably null Het
Sec16a T C 2: 26,414,390 D2303G probably damaging Het
Slc16a5 A G 11: 115,472,778 K422E possibly damaging Het
Slc22a30 A T 19: 8,386,527 M232K probably damaging Het
Slc35b3 A T 13: 38,937,758 F300I probably damaging Het
Spata2l A G 8: 123,235,720 V34A probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Tecta T A 9: 42,345,589 Q1597L possibly damaging Het
Tgfb1i1 A T 7: 128,248,547 probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tpm3-rs7 A G 14: 113,315,375 T234A probably benign Het
Usp20 A G 2: 31,017,508 Y684C probably damaging Het
Zc3h4 T A 7: 16,429,611 M585K unknown Het
Zfp292 A G 4: 34,806,747 I2099T probably damaging Het
Other mutations in Olfr46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Olfr46 APN 7 140610753 missense probably damaging 1.00
IGL02408:Olfr46 APN 7 140610931 missense probably damaging 1.00
IGL02496:Olfr46 APN 7 140610168 start codon destroyed probably benign
IGL03003:Olfr46 APN 7 140610370 missense probably damaging 1.00
R0538:Olfr46 UTSW 7 140610384 missense probably damaging 1.00
R1350:Olfr46 UTSW 7 140610709 missense probably damaging 0.96
R1466:Olfr46 UTSW 7 140610969 missense probably benign 0.01
R1466:Olfr46 UTSW 7 140610969 missense probably benign 0.01
R2008:Olfr46 UTSW 7 140610585 missense probably damaging 1.00
R4110:Olfr46 UTSW 7 140610264 missense probably benign 0.20
R4110:Olfr46 UTSW 7 140610265 missense possibly damaging 0.89
R4255:Olfr46 UTSW 7 140610587 nonsense probably null
R4622:Olfr46 UTSW 7 140610698 nonsense probably null
R4809:Olfr46 UTSW 7 140611074 missense probably damaging 0.98
R4826:Olfr46 UTSW 7 140610319 missense probably benign 0.02
R4989:Olfr46 UTSW 7 140610391 missense possibly damaging 0.95
R5177:Olfr46 UTSW 7 140610189 missense probably benign 0.00
R5261:Olfr46 UTSW 7 140610663 missense probably benign 0.00
R5863:Olfr46 UTSW 7 140610631 missense probably damaging 0.97
R6082:Olfr46 UTSW 7 140610681 missense probably benign 0.00
R6705:Olfr46 UTSW 7 140610784 missense probably damaging 0.99
R7216:Olfr46 UTSW 7 140610460 missense possibly damaging 0.87
R7443:Olfr46 UTSW 7 140611048 missense probably damaging 1.00
R7485:Olfr46 UTSW 7 140610178 missense probably benign 0.02
R7806:Olfr46 UTSW 7 140610772 missense probably benign 0.00
R8373:Olfr46 UTSW 7 140610295 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATAGCGTTATGACTCTTGTGGC -3'
(R):5'- CTCCATGAGGCTTCCCTTAG -3'

Sequencing Primer
(F):5'- ATGACTCTTGTGGCAGATGC -3'
(R):5'- CCCTTAGAAGAGCATTTTAGGAACC -3'
Posted On2016-11-21